PubMed Health⌕ Search

Biomedical subjects

H Domdey

Publications and source records attributed to H Domdey.

At least 73 records · Page 4Linked to original sources
PubMed1984

Nucleotide sequence of complementary DNA and derived amino acid sequence of murine complement protein C3.

The nucleotide sequences coding for murine complement component C3 have been determined from a cloned genomic DNA fragment and several overlapping cloned complementary DNA fragments. The amino acid sequence of the protein was deduced. The mature beta and alpha subunits contain 642 and 993 amino acids respectively. Including a 24 amino acid signal peptide and four arginines in the beta-alpha transition region, which are probably not contained in the mature protein, the unglycosylated single chain precursor protein preproC3 would have a molecular mass of 186 484 Da and consist of 1663 amino acid residues. The C3 messenger RNA would be composed of a 56 +/- 2 nucleotide long 5' non-translated region, 4992 nucleotides of coding sequence, and a 3' non-translated region of 39 nucleotides, excluding the poly A tail. The beta chain contains only three cysteine residues, the alpha chain 24, ten of which are clustered in the carboxy terminal stretch of 175 amino acids. Two potential carbohydrate attachment sites are predicted for the alpha chain, none for the beta chain. From a comparison with human C3 cDNA sequence (of which over 80% has been determined) an extensive overall sequence homology was observed. Human and murine preproC3 would be of very similar length and share several noteworthy properties: the same order of the subunits in the precursor, the same basic residue multiplet in the beta-alpha transition region, and a glutamine residue in the thioester region. The equivalent position of the known factor I cleavage sites in human C3 alpha could be located in the murine C3 alpha chain and the size and sequence of the resulting peptide were deduced. A comparison of the amino acid sequences of murine C3 and human alpha 2-macroglobulin is given. Several areas of strong sequence homology are observed, and we conclude that the two genes must have evolved from a common ancestor.

Amino Acid Sequence↗
PubMed1984

Synthesis of RNA I by the RNA polymerase from Micrococcus luteus on the Escherichia coli plasmid pBR322.

Incubation of DNA-dependent RNA polymerase from Micrococcus luteus (gram-positive) with the plasmid pBR322 under transcription conditions in vitro leads to the formation of a rather short-chained RNA. This transcript is initiated at the same site on pBR322 as RNA I, a defined Escherichia coli RNA polymerase product. M. luteus RNA polymerase initiates transcription at the RNA I site much more efficiently than the E. coli enzyme, using either a plasmid preparation of pBR322 or an appropriate linear restriction fragment as template. In the latter case, cleavage of the restriction fragment 24 or 71 nucleotides (but not 91 nucleotides) upstream of the initiation site destroys template activity. By sequence analysis it was determined that the 3' terminus of the M. luteus RNA polymerase transcription product is identical with that known for RNA I. Moreover, in agreement with synthesis of RNA I by E. coli RNA polymerase in vitro, termination by the M. luteus enzyme is also a stutter process characterized by the same dependence on the available UTP concentration. These observations lead to the hypothesis that termination by eubacterial RNA polymerases might not be species-specific.

Base Sequence↗
PubMed1984

Lariat structures are in vivo intermediates in yeast pre-mRNA splicing.

Transcripts from an ADC1-actin gene fusion containing the yeast actin intron are efficiently spliced in vivo. Four distinct forms of the excised actin intron are found in poly(A)- RNA from yeast carrying this transcription unit on a multicopy plasmid. Two of them migrate abnormally slowly in polyacrylamide gels, and one of these contains a block to reverse transcription at the conserved UACUAAC sequence (TACTAAC box). We also detect a larger RNA in the poly(A)+ fraction with abnormal gel mobility and the same reverse transcriptase block. Analysis of the major species of excised actin intron, labeled with 32P in vivo, reveals the presence of a branch at the third A in the UACUAAC sequence. This A is linked via a 3'-5' phosphodiester bond to the downstream C, and via a 2'-5' phosphodiester bond to a G, presumably from the 5' end of the intron. Thus this intron RNA is in the form of a lariat.

Actins↗
PubMed1983

Sequence analysis of the cloned mRNA coding for glyceraldehyde-3-phosphate dehydrogenase from chicken heart muscle.

Using a cloned cDNA (pGAP30) the nucleotide sequence for chicken glyceraldehyde-3-phosphate dehydrogenase mRNA has been determined. The cDNA insert contains 1051 nucleotides representing the amino acid coding sequence, with the exception of 49 NH2-terminal amino acids, and includes the entire 3'-noncoding region. Sequence information on the missing 5' terminus of the mRNA, not represented in the clone pGAP30, was obtained by extension of the cDNA using an 85-nucleotide-long internal fragment as a primer. Thus the sequence of 310 amino acids of chicken glyceraldehyde-3-phosphate dehydrogenase representing 93% of the complete primary structure could be derived. The coding portion exhibits non-random utilization of synonymous codons with a strong bias for codons with G or C at the third position. The non-coding region contains several octanucleotides which are repeated and shows a potentially stable stem-and-loop structure located towards the end of the mRNA. Hypothetical functional implications of the putative secondary structure are discussed.

Amino Acid Sequence↗
PubMed1983

Structure and expression of the C3 gene.

To map the multiple interactive sites on the C3 polypeptide, it is advantageous to combine the approaches of protein chemistry, nucleic acid technology, and molecular biology. This review summarizes the currently known molecular properties of mouse liver C3 mRNA, cloned C3 cDNA, and genomic DNA. Original data communicated have specified the amino acid sequence of the 215 amino-terminal residues of mature mouse C3 beta. Southern blot analysis of liver DNA indicated that the mouse genome contains only one type of C3 gene, that murine and human C3 sequences strongly cross-hybridize, and that the human C3 gene is not somatically rearranged. Included are descriptions of the first human C3 genomic DNA clones, their preparation, and their use to map the human C3 gene to chromosome 19 in linkage with the myotonic dystrophy (DM) locus. After a brief survey of reports describing inherited human C3 deficiencies, we discuss a Dutch family and their three members with total homozygous C3 deficiency who were the subjects of a recent publication. The restricted synthesis of C3 in major and minor producer tissues is discussed and it is proposed that the C3 gene provides a good model system for studying the molecular basis of tissue-specific gene expression. Data are presented documenting the production of C3 in two established mouse macrophage-like cell lines and two rat hepatoma cell lines in tissue cultures. A short account covers the extensive literature on regulation of C3 serum concentrations in acute and chronic inflammation and the very incomplete picture that presently depicts hormonal regulation of C3 synthesis. The final experiment reported demonstrates that nucleic acid hybridization with cloned cDNA probes is a sensitive assay for quantitative determinations of C3 mRNA. With the help of cloned cDNA and genomic DNA, researchers can address questions concerning the functional topography of the C3 polypeptide, the gene's structure, and the molecular nature of inherited C3 deficiencies in humans.

Animals↗
PubMed1982

Cloning, partial sequencing, and expression of glyceraldehyde-3-phosphate dehydrogenase gene in chick embryonic heart muscle cells.

Two recombinant plasmids containing structural gene sequences of chick embryonic heart glyceraldehyde-3-phosphate dehydrogenase (GAP dehydrogenase) were constructed and characterized. The plasmids pGAP 30 and pGAP 36 have inserts of 1200 and 950 base pairs, respectively. The identity of the clones was established by hybrid-arrested and hybrid-selection translation assays, and by immunoprecipitation of hybrid-selected translation product with GaP dehydrogenase antiserum. Hybridization of labeled pGAP 30 DNA to size-fractionated chick heart poly(A) RNA occurred at the region on the gel corresponding to the mobility of GAP dehydrogenase mRNA. Base sequence analysis of plasmid pGAP 30 and the comparison of the amino acid sequence derived from it with that of pig muscle GAP dehydrogenase revealed that the amino acid sequence of GAP dehydrogenase is strictly conserved between the chick and pig muscle tissues. Expression of GAP dehydrogenase mRNA in developing chick heart cells in cultures was monitored by in situ hybridization. The GAP dehydrogenase mRNA was present in 5-h-old dividing myoblasts, in contrast to mRNAs specific for contractile proteins, which appear late in myoblast development paralleling morphogenetic differentiation of myoblasts into myocytes (Jakowlew, S. B., Khandekar, P., Datta, K., Narula, S. K., Arnold, H. H., and Siddiqui, M. A. Q. (1982) J. Mol. Biol. 156, 673-682).

Amino Acid Sequence↗
PubMed1982

Isolation and analysis of genomic DNA clones encoding the third component of mouse complement.

A gene library was constructed with DNA from strain A mice by using the phage lambda vector lambda 1059. By screening with cloned cDNA for the third component of mouse complement, C3, four different C3 genomic clones were isolated from this library. Two of the recombinant phages carry insertions of 14 and 18 kilobase pairs, respectively, which together cover one complete copy of the C3 gene and several hundred nucleotides of its 5' and 3' flanking sequences. The distance from the 5' end of the gene, which includes the hexanucleotide T-A-T-A-A-A and a translation initiation codon, to its 3' end as defined by the poly(A) attachment site is 24 kilobase pairs. From the genomic DNA sequence, a signal peptide of 24 amino acid residues is predicted at the NH2 terminus of the initial translation product. The signal peptide and the next two amino acids are encoded by the first exon of this gene.

Animals↗
PubMed1982

Characterization of the mRNA and cloned cDNA specifying the third component of mouse complement.

Eighteen cDNA clones containing inserts specific for the third component of complement (C3) have been derived from high molecular weight mouse liver mRNA. The inserts span 4,600 nucleotides of the C3 coding sequence, including the 3' end of C3 mRNA. The length of C3 mRNA was determined to be 5,100 +/- 200 nucleotides, including a poly(A)-containing tail of mean length 170 nucleotides. From cDNA sequence analysis of the 5'-proximal region of C3 mRNA, the NH2-terminal amino acid sequence of the mature C3 beta chain was predicted to be Ile-Pro-Met-Tyr-Ser-Ile-Ile-Thr-Pro-Asn-Val-Leu-Arg-Leu-Glu. This sequence is in good agreement with the reported amino acid sequences of human and guinea pig C3 beta chains. These data position the C3 beta subunit to the NH2-terminal portion of the precursor C3 molecule (pro-C3) and establish the order of subunits in pro-C3 to be NH2-beta-alpha-COOH. In addition, the cDNA sequence indicates that an NH2-terminal extension peptide precedes the beta chain in pro-C3. The amino acid sequence of the mouse C3a fragment and its flanking regions was determined. The data indicate the presence of four arginine residues located between the COOH terminus of the C3 beta and the NH2 terminus of the C3 alpha subunits in pro-C3. The coding sequences of the amino acids that constitute the internal thioester domain in C3 were determined. Unexpectedly, the glutamyl residue that has been shown to participate in the thioester bond in native C3 was found to be encoded as a glutamine.

Animals↗
PubMed1982

Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid.

The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence. Maximal base-pairing of the established CEV and CSV sequences results in an extended rod-like secondary structure similar to that previously established for PSTV and as predicted from detailed physicochemical studies of all these viroids. Although the three viroid species sequenced to date differ in size and nucleotide sequence, there is 60--73% homology between them. As PSTV, CEV and CSV also contain conserved complementary sequences which are separated from each other in the native secondary structure. We postulate that the resulting 'secondary' hairpins, being formed and observed in vitro during the complex process of thermal denaturation of viroid RNA, must have a vital, although yet unknown, function in vivo. The possible origin and function of viroids are discussed on the basis of the characteristic structural features and of a considerable homology with U1a RNA found for a region highly conserved in the three viroids.

Base Sequence↗
PubMed1982

Species specificity of promoter recognition by RNA polymerase and its transfer by the sigma factor.

RNA polymerase holoenzyme from Micrococcus luteus synthesizes in vitro a run-off transcript of 85 nucleotides from a DNA fragment containing part of gene E of bacteriophage phi X174. This RNA starts with GTP as the 5' terminus 18 nucleotides downstream from the start of gene E on the viral (+)strand. Transcription does not occur when the fragment is cleaved 36 nucleotides upstream of the initiation site. No transcript is obtained with RNA polymerase core or holoenzyme from Escherichia coli. Other DNA fragments containing the three major E. coli promoters of phi X174 are transcribed by both enzymes although much less efficiently by M. luteus RNA polymerase. When subunit sigma in E. coli RNA polymerase is replaced by sigma from M. luteus the resulting hybrid enzyme actively transcribes the DNA fragment containing the inner region of gene D with formation of the same run-off transcript which is obtained with M. luteus holoenzyme. In the presence of sigma from E. coli this RNA is not synthesized. The hybrid enzyme also transcribes a DNA fragment containing the gene A promoter of phi X174 with even higher efficiency than RNA polymerase holoenzyme from E. coli.

Bacillus subtilis↗
PubMed1981

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

Base Sequence↗
PubMed1981

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Base Sequence↗
PubMed1981

Binding of ribosomes to linear and circular forms of the 5'-terminal leader fragment of tobacco-mosaic-virus RNA.

The sequence of the 5'-terminal leader fragment preceding the AUG codon in the RNA of tobacco mosaic virus (TMV), tomato strain, SPS isolate, has been determined. This RNA, similarly to the RNAs of the U1 and Dahlemense strains of TMV [Kukla et al. (1979) Eur. J. Biochem. 98, 61--66] has the 7-methylguanosine(5')triphospho(5')guanosine cap separated from the initiation codon by a long stretch of nucleotides devoid of guanosine residues. The RNase-T1-resistant 73-nucleotide-long leader fragment of TMV RNA from the SPS isolate was assayed for its ability to interact with eukaryotic and prokaryotic ribosomes. The linear fragment, labelled either at its 5' or 3' end, efficiently formed disome initiation complexes when incubated with wheat-germ protein-synthesis extract. In contrast to its linear counterpart, the circular covalently closed RNA leader fragment, obtained in a reaction catalysed by T4 RNA ligase, was unable to interact with wheat germ ribosomes. Both kinds of leader fragment bound equally well to Escherichia coli 70-S ribosomes. The results offer further support to the notion that in eukaryotic initiation the free 5' end (either capped or uncapped) is required for mRNA interaction with ribosomes. Furthermore, they suggest that both ribosomes found in disome initiation complexes with the TMV RNA leader fragment enter the mRNA sequentially via the free 5' terminus.

Base Sequence↗
PubMed1978

Nucleotide sequence and secondary structure of potato spindle tuber viroid.

The viroid of the potato spindle tuber disease (PSTV) is a covalently closed ring of 359 ribonucleotides. As a result of intramolecular base pairing, a serial arrangement of double-helical sections and internal loops form a unique rod-like secondary structure. PSTV is the first pathogen of a eukaryotic organism for which the complete molecular structure has been established.

Base Sequence↗