PubMed Health⌕ Search

Biomedical subjects

H Fukuhara

Publications and source records attributed to H Fukuhara.

At least 127 records · Page 7Linked to original sources
PubMed1985

A fine restriction map of the linear mitochondrial DNA of Tetrahymena pyriformis: genome size, map locations of rRNA and tRNA genes, terminal inversion repeat, and restriction site polymorphism.

A fine restriction map of the linear mitochondrial DNA of Tetrahymena pyriformis strain ST is presented. 1. Based on agarose gel electrophoresis data together with limited nucleotide sequences available on some restriction fragments, we estimate the actual size of this genome to be about 55,000 base pairs. 2. Seven tRNA gene locations have been assigned, which are scattered along the genome length. Six of these locations encode the genes for tRNA(phe), tRNA(his), tRNA(trp), and tRNA(glu), and the duplicate tRNA(tyr) genes which are located at the inverted terminal repeat segments. The tRNA gene(s) encoded in one location has not been identified. We have not yet found the tRNA(leu) and tRNA(met) genes, which were previously shown to be encoded in the genome (Chiu et al. 1974; Suyama 1982). 3. We have mapped the 14S rRNA gene by sequencing the 170 bp segment of EcoRI fragment 8 and by aligning its sequence with E. coli 16S rRNA. From our recent complete sequence data the gene size was found to be about 1,650 bp, which is unexpectedly large for the 14S rRNA which has an estimated size of 1,300 bp. The 14S rRNA is probably a cleavage product of the larger primary transcript of which 200-300 bases of the 5' end are missing. 4. The duplicate copies of the 21S rRNA gene at the terminal duplication inversion segments were analyzed. ClaI fragment 7 (1,500 bp) corresponds in sequence from base position 850 to 2,390 of the 20S rRNA gene of Paramecium mitochondrial DNA (Seilhamer et al. 1984b). The 21S gene is approximately 2,500 bp long. The presence of some restriction site polymorphism is apparent in this segment. 5. Each of the 21S gene copies precedes the tRNA(tyr) gene, but the space flanking one tRNA(tyr) gene differs in size and restriction sites from the space flanking another tRNA(tyr) gene. Thus, this space corresponds to the segment of an imperfect match in the terminal duplication inversion of Goldbach et al. (1978a). 6. Saccharomyces cerevisiae mitochondrial probes including Cob, ATPase VI and IX, and cytochrome oxidase I gene sequences, 21S and 15S rRNAs, and mouse mitochondrial DNA showed no significant hybridization with any restriction fragments of Tetrahymena mitochondrial DNA. The results are in accordance with an extensive sequence divergence previously found in the Tetrahymena mitochondrial genome (Goldbach et al. 1977).

Animals↗
PubMed1984

Erythromycin and spiramycin resistance mutations of yeast mitochondria: nature of the rib2 locus in the large ribosomal RNA gene.

Two linked genetic loci, rib 2 and rib 3, of yeast mitochondrial genome are the sites of mutations that confer resistance to erythromycin and/or spiramycin. We have examined two mutations at the rib 2 locus. Mutation ER354 was found at the nucleotide position 3993 of the large ribosomal RNA gene; it corresponded to a C to G transversion leading to a double resistance to erythromycin and spiramycin. Mutation SR551 was found also at the same position, but the C was replaced by a T, conferring resistance to spiramycin only. Rib 2 and rib 3 are 836 base pairs apart on the gene sequence, but are very close to each other in the secondary structure of ribosomal RNA.

Base Composition↗
PubMed1983

Inverted terminal repetitions of the two linear DNA associated with the killer character of the yeast Kluyveromyces lactis.

The killer character of some Kluyveromyces lactis strains is associated with the presence of two linear double-stranded DNA, pGKl-1 (or k1) and pGKl-2 (or k2). Nucleotide sequencing has revealed that each DNA has inverted terminal repetitions of about 200 base-pairs whose 5' ends seem to be blocked. The repetitions of the two DNA do not share extensive sequence homology. The role of these repetitions in the replication of killer DNA is discussed.

Ascomycota↗
PubMed1983

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.

Base Sequence↗
PubMed1983

Characterization of a yeast mitochondrial locus necessary for tRNA biosynthesis. Deletion mapping and restriction mapping studies.

Yeast mitochondrial DNA codes for a complete set of tRNAs. Although most components necessary for the biosynthesis of mitochondrial tRNA are coded by nuclear genes, there is one genetic locus on mitochondrial DNA necessary for the synthesis of mitochondrial tRNAs other than the mitochondrial tRNA genes themselves. Characterization of mutants by deletion mapping and restriction enzyme mapping studies has provided a precise location of this yeast mitochondrial tRNA synthesis locus. Deletion mutants retaining various segments of mitochondrial DNA were examined for their ability to synthesize tRNAs from the genes they retain. A subset of these strains was also tested for the ability to provide the tRNA synthesis function in complementation tests with deletion mutants unable to synthesize mature mitochondrial tRNAs. By correlating the tRNA synthetic ability with the presence or absence of certain wild-type restriction fragments, we have confined the locus to within 780 base pairs of DNA located between the tRNAMetf gene and tRNAPro gene, at 29 units on the wild-type map. Heretofore, no genetic function or gene product had been localized in this area of the yeast mitochondrial genome.

Chromosome Deletion↗
PubMed1983

Unequal excision of complementary strands is involved in the generation of palindromic repetitions of rho- mitochondrial DNA in yeast.

In the rho- mutants of yeast, the mitochondrial genome is made up of a small segment excised from the wild-type mitochondrial DNA. The segment is repeated either in tandem or in palindrome to form a series of multimeric DNAs. We have asked how the palindromic organization arises. From several palindromic rho- mitochondrial DNAs, we have isolated the restriction fragments that contained the head-to-head or tail-to-tail junction of the repeating units, and have determined their nucleotide sequences. We found that the palindromes were not symmetrical right up to the junction points: at the junction, there was always an asymmetrical sequence of variable length. At both ends of this junction sequence, we found inverted oligonucleotide sequences that were variable in each mutant and that were present in the wild-type DNA. At the moment of excision, a single-strand cut seems to occur at each of these short inverted repeats, in such a way that the two complementary strands of the genome are cut unequally and the single-stranded overhangs become the junction sequences between the palindromic repeating units. This scheme may account for the complex structures of many rho- mitochondrial DNAs.

Base Sequence↗
PubMed1983

Purification and quantitative chemical analysis of cell wall peptidoglycans of Leptotrichia buccalis.

Peptidoglycans of Leptotrichia buccalis ATCC 14201 and ATCC 19616 were isolated by extraction with sodium dodecyl sulfate and subsequent digestion of the sodium dodecyl sulfate-insoluble residue with proteases and alpha-amylase. Cell wall fractions obtained by sodium dodecyl sulfate extraction and protease digestion were highly contaminated by a glucose polymer. The polyglucose was removed by alpha-amylase treatment, and the peptidoglycans were left behind. Analyses with amino acids and amino sugars of the cell wall fractions and peptidoglycan specimens revealed that D-glutamic acid, D-alanine, L-alanine, meso-2,6-diaminopimelic acid (A2pm), muramic acid, and glucosamine were the principal components. The dinitrophenylation method revealed that about half of the A2pm residue had a free amino group, and analysis by hydrazinolysis showed that a small part of alanine and A2pm was located at the C terminal. The above results indicate that one of the amino groups of the A2pm residue at one strand of the stem peptide subunit cross-linked to the carboxyl group of alanine of the neighboring strand. It was thus revealed that the peptidoglycans of L. buccalis belong to the A1 gamma type of the classification by Schleifer and Kandler (Bacteriol. Rev. 36:407-477).

Amino Acids↗
PubMed1983

Transformation of Kluyveromyces lactis by killer plasmid DNA.

Some strains of Kluyveromyces lactis contain two linear double-stranded DNA plasmids, k1 and k2. The presence of the two plasmids confer on the cell a "killer" character, due to the production of a toxin that kills the sensitive cells. We have used one of these linear DNA molecules as a gene vector to transform K. lactis cells. Hybrid plasmids containing parts of the k1 plasmid and the URA3 gene of Saccharomyces cerevisiae have been constructed. We have found that the hybrid plasmids were able to transform a uracil-requiring strain of K. lactis (uraA mutant) to a prototrophic form. The transformed phenotype cosegregated with the hybrid plasmids. The transforming plasmids contained the sequence of one or both ends of the linear k1 DNA, but they were integrated into a circular molecule.

Ascomycota↗
PubMed1983

Role of nuclear genes in expression of a mitochondrial tRNA gene in Saccharomyces cerevisiae.

In yeast mitochondria, most of the isoaccepting species of tyrosyl tRNA are coded by a mitochondrial gene, tyrA. A particular isoaccepting species is coded by a second mitochondrial gene, tyrB. This gene is not expressed in certain strains of yeast which show no deficient phenotype. Genetic crosses between strains expressing or not expressing the tyrB gene demonstrate that expression is controlled by specific nuclear genes and that a mutation of the tyrA gene can be bypassed when the tyrB gene is operative.

Cell Nucleus↗
PubMed1982

Identification of two erythromycin resistance mutations in the mitochondrial gene coding for the large ribosomal RNA in yeast.

Two independent erythromycin resistance mutations, ER514 and ER221, have been identified in the mitochondrial gene coding for the 21S ribosomal RNA. The two mutations were found to be identical, corresponding to a A to G transition at the nucleotide position 1951 of the ribosomal RNA gene. In the secondary structure model of the ribosomal RNA, the ER resistance site is found at the proximity of the chloramphenicol resistance sites located about 500 bases downstream.

Animals↗
PubMed1982

Molecular cloning of partial cDNA copies of two distinct mouse IFN-beta mRNAs.

Two cDNA libraries were constructed, using respectively the 12S and the 16S sucrose gradient fractions of polysomal poly (A)+ RNA from mouse C243 cells induced with Newcastle disease virus. Screening of a part of both libraries by mRNA selection hybridization assays revealed the presence of two plasmids hybridizing to an mRNA, whose translation product was characterized as mouse IFN-beta. Blot analysis of RNA indicated that mRNA hybridizing to the DNA from both plasmids could be detected in induced but not in uninduced C243 cells. The two cDNA inserts did not cross hybridize and had distinct restriction maps. Sequencing revealed that both inserts represented the end of the coding region and the entire 3' non coding region of two district mRNAs. Although different, the putative 39 AA and 65 AA carboxy termini of both Mu IFN-beta s display some homology to human IFN-beta 1. Thus there are at least two different murine IFN-beta genes.

Amino Acid Sequence↗
PubMed1982

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Base Sequence↗