PubMed Health⌕ Search

Biomedical subjects

H J Lin

Publications and source records attributed to H J Lin.

At least 199 records · Page 11Linked to original sources
PubMed1988

Molecular basis of beta thalassemia in south China. Strategy for DNA analysis.

The phenotype of beta thalassemia can be caused by over 40 different mutations. To set up a prenatal diagnosis program using DNA analysis, it is important to determine the type and frequency of mutation in a particular geographic area. We have delineated the molecular lesions that cause beta thalassemia in the Guangdong province of China, and found six mutations in four different haplotypes. The surprising finding that five of these mutations each occur in two different haplotypes suggests the occurrence of crossing over or gene conversion events at the beta-globin locus. The delineation of the haplotypes and mutations will permit the choice of the appropriate probes for prenatal detection of beta thalassemia in this part of China.

China↗
PubMed1988

Heat probe therapy for severe hemorrhage from a peptic ulcer with a visible vessel.

Over a period of 9 months we treated 50 patients with upper gastrointestinal bleeding from a peptic ulcer with a visible vessel. Their mean age was 58.8 years. Almost all cases had massive bleeding and required an average of 1930 +/- 2174 ml (S. D.) of blood. Twenty-eight cases were in shock when treated. The lowest mean hemoglobin was 8.2 +/- 2.2 gm/dl (S. D.). We treated them with the Olympus GIF-1T10 and the heat probe unit. A total of 825 +/- 735 joules (S. D. ) were applied to each bleeder. Forty-nine cases (98%) stopped bleeding after initial treatment. Seven cases (14.3%) rebled within one week post-treatment. We tried heat probe therapy again in 6 of the cases that rebled, and achieved hemostasis in four of them. Ultimately, only four failures were seen in our study. The success rate was 92% (46/50). We conclude that thermocoagulation with the heat probe may in the near future replace surgery in the majority of cases of hemorrhage from a peptic ulcer with a visible vessel in its base.

Adult↗
PubMed1988

Huge splenic artery aneurysm after portocaval shunt.

A 64-year-old man with cirrhosis of the liver had a palpable, pulsatile palm-size mass over the upper abdomen. Splenic artery aneurysm was diagnosed by sonography, computed tomography scan, and celiac angiography. Operative findings showed a huge splenic artery aneurysm (20 X 30 X 20 cm) over the middle portion of the splenic artery. Such a huge splenic artery aneurysm may develop because changes in splenic circulatory dynamics after a portocaval shunt, resulting in compression of the splenic vein and congestive splenomegaly.

Aneurysm↗
PubMed1988

Heater probe in massive peptic ulcer hemorrhage and shock.

We treated 35 patients in shock from massive peptic ulcer hemorrhage with the heater probe (HP). Twelve of them (34.3%) were poor surgical candidates. Their mean age was 62.3 years. All had massive bleeding, requiring an average of 2,300 ml of blood transfusion. The average lowest mean hemoglobin was 7.94 g/dl. We used the Olympus GIF-1T10 and the HP unit, applying an average of 899 J to each bleeder. In 34 patients (97.1%) hemostasis was achieved after initial treatment. Six patients (17.6%) rebled within 1 week. With HP therapy in those six we achieved hemostasis in five (83.3%). Ultimately, only two cases failed in this study, to give a success rate of 94.3% (33/35). We conclude that HP thermocoagulation may, in the near future, replace operations in many patients with massive peptic ulcer hemorrhage.

Aged↗
PubMed1988

Pseudomelanosis duodeni. Case report and review of literature.

Pseudomelanosis duodeni is an extremely rare disease that has been only recently recognized. We present what we take to be the first Oriental case with typical endoscopic and histological manifestations. With detailed studies of histochemistry and electron microscopy, we have confirmed that the pigment is composed of iron and lipofuscin. A detailed review of the literature may be found here.

China↗
PubMed1988

A prospectively randomized trial of heat probe thermocoagulation versus pure alcohol injection in nonvariceal peptic ulcer hemorrhage.

We conducted a prospectively randomized trial of 78 patients with peptic ulcer hemorrhage to evaluate the hemostatic effects of heat probe thermocoagulation and pure alcohol injection. The initial and ultimate success rates of heat probe thermocoagulation were better than those of pure alcohol injection (p less than 0.05). Rebleeding rates and success rates of retreatment in the two groups were not significantly different. In the case of a spurter or a bleeder located over the lesser curvature side of the stomach or superior wall of the duodenal bulb, heat probe thermocoagulation was better than pure alcohol injection in achieving hemostasis. We conclude that heat probe thermocoagulation is better than pure alcohol injection in arresting peptic ulcer hemorrhage. If the bleeder is a spurter or is located over the lesser curvature side of the stomach or superior wall of the duodenal bulb, heat probe thermocoagulation is the treatment of choice.

Adult↗
PubMed1987

Placebo-controlled trial of recombinant alpha 2-interferon in Chinese HBsAg-carrier children.

24 Chinese children aged 1.5-5 years and positive for hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), hepatitis B virus DNA polymerase (HBV DNAp), and HBV DNA on at least three occasions in the 6 months before the trial were randomised to receive either vitamin B complex or intramuscular recombinant alpha 2-interferon (r-IFN) ('Roferon') 10 X 10(6) IU/m2 thrice weekly for 12 weeks. In all 12 subjects receiving r-IFN, HBV DNAp and HBV DNA levels fell during the course of r-IFN injections. Within 4 weeks of cessation of r-IFN injection, the HBV DNAp and HBV DNA returned to pre-trial levels except in 2 subjects, in whom loss of HBV DNAp and HBV DNA was sustained for up to 18 months from onset of the trial. 1 child lost HBeAg at 18 months. 2 of the 12 children in the placebo group also had a sustained loss of HBV DNAp and HBV DNA during the 18 months, with 1 child losing HBeAg at 18 months. All 24 subjects remained positive for HBsAg. r-IFN produced very slight side-effects except for pyrexia and the "flu" syndrome, both of which showed rapid tachyphylaxis. In the dose given r-IFN was safe but had no long-term beneficial effects on HBsAg carriage in Chinese children.

Carrier State↗
PubMed1987

Differences in diazepam pharmacokinetics in Chinese and white Caucasians--relation to body lipid stores.

We have compared diazepam pharmacokinetics in 16 Chinese and 18 white Caucasian healthy male volunteers, resident in Hong Kong and have correlated them with physical attributes. Serum concentrations of diazepam and desmethyldiazepam were measured in venous blood by an enzyme-linked immunoassay (0-3 h samples) and HPLC (3-72 h samples). Pharmacokinetic parameters were derived assuming a two compartment model, distribution phase less than 6 h, and 100% oral systemic availability. Compared with the Chinese the white Caucasians were older, heavier, taller, and fatter, as judged by skin fold thickness (SFT) and total body weight to 'Ideal' body weight (TBW/IBW) ratio; respective mean differences being 16%, 27%, 4%, 26%, and 15% (p less than 0.05). Mean diazepam apparent volume of distribution (V) and V/IBW were larger in the white Caucasians (52% & 39% respectively, p = 0.002). SFT and TBW/IBW ratio yielded the best correlations with V, V/TBW and V/IBW (0.50-0.75, p less than 0.05). Obesity indices contributed most to the overall regressions (R2 up to 0.52), and for V there was a further small effect (2%, partial F test) due to ethnic group, possibly reflecting stature. Mean peak diazepam concentration (Cmax) was similar in both ethnic groups. Time to Cmax (tmax) was more often prolonged in the Chinese (chi 2 test, p = 0.01). Body fat and stature may thus account for these inter-ethnic differences in the apparent volume of distribution of diazepam, a highly lipid-soluble drug.

Adult↗
PubMed1987

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum.

A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.

Animals↗
PubMed1987

Nonoperative treatment of Hirschsprung's disease: a new approach.

The approach of the combined traditional Chinese and modern medicinal treatment of Hirschsprung's disease has been applied in 90 cases. Long-term follow-up showed satisfactory results. Of these, 55 cases with a typical history, plus a positive ACHE and x-ray were selected for analysis and discussion, making an over all rate of 78.18%. This treatment is particularly useful for those babies under 1 year of age with a short narrow segment of the rectum. In addition, it would be a good trial procedure for those babies over 1 year old with mild symptoms and the narrow segment just beyond the sigmoidorectal junction.

Acupuncture Therapy↗
PubMed1987

Hepatitis B virus infection in Chinese families in Hong Kong.

Between January 1983 and July 1984, 731 family members of 240 hepatitis B surface antigen (HBsAg) carriers were screened for hepatitis B virus markers. The percentage of those who were positive for HBsAg was 28.3 and that for antibody to hepatitis B surface antigen/antibody to hepatitis B core antigen was 43.1. The carrier rate was higher among siblings (53%) and offspring (50.5%) of female carriers, but similar to that of the age-matched general population for spouses (10.8%). Maternal transmission was the most important mode of spread of hepatitis B virus infection within the family. The HBsAg-positive offspring and siblings were clustered within certain families. Intrafamilial spread is important in perpetuating hepatitis B virus infection in Chinese persons. Susceptible family members, especially newborns and other young children of female carriers, should be vaccinated.

Adolescent↗