PubMed Health⌕ Search

Biomedical subjects

H Küpper

Publications and source records attributed to H Küpper.

At least 37 records · Page 2Linked to original sources
PubMed1989

[Dentist-patient communication under time constraints].

In the present clinical trial dentists were asked to talk to patients about the subject of "Prevention". A patient-dentist conversation was to be conducted in two different time frames. In the first group the dentist took as much time as seemed necessary for communicating with the patient. In the second group the restricting condition was that approximately an average number of patients had appointments under office conditions. The results demonstrate that under controlled conditions dentists show a communicative behavior which will focus the patients attention on compliant oral hygiene. However, under the pressure of limited time, this behavior will no longer be sufficient to achieve optimum patient compliance through such a talk alone.

Attitude of Health Personnel↗
PubMed1988

Characterization of cDNA encoding human placental anticoagulant protein (PP4): homology with the lipocortin family.

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10(6)independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA we identified 9 other recombinants encoding a protein with considerable similarity (74%) TO PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I.

Amino Acid Sequence↗
PubMed1984

Nucleotide sequence of the VP1 gene of the foot-and-mouth disease virus strain A Venceslau.

The VP1 coat protein of FMDV strain A Venceslau (Aven) consists of 213 amino acid residues. Serum neutralization tests demonstrated that strain Aven is closely related to strain A Argentina/79 (A79) but significantly different from strain A24Cruzeiro (A24). There is a strong correlation between the amino acid sequences and the serological data. Nucleotide and amino acid sequence analyses of VP1 showed that serologically related viruses (Aven and A79) differ less in this region of the genome than those of serologically distinct viruses (Aven vs. A24). The most significant variation between Aven and A24 occurs at amino acid positions 43 to 46, in which all four residues are different.

Amino Acid Sequence↗
PubMed1984

Biotechnological approach to a new foot-and-mouth disease virus vaccine.

Major contributions towards the development of an absolutely safe FMDV vaccine are evident. With the identification of VP1 as the immunogenic protein, it is possible to manufacture a subunit vaccine via biotechnology. DNA sequences encoding the VP1 protein can be introduced into a bacterium with ease; under the appropriate conditions, large amounts of VP1 can be produced in a short time. The accumulation of amino acid sequences generated by recombinant DNA techniques allows identification of antigenic domains, which are the basis of variability among serotype and subtype viruses. As a result, vaccine production by chemical synthesis of short peptides corresponding to the antigenic determinants is greatly facilitated. At present, results from experimental vaccines employing genetically engineered or chemically synthesized VP1 antigens against homologous virus infection are encouraging. The current approach of preparing vaccine is to utilize the antigenic specificity of the virus. Since FMDV undergoes antigenic drift, variants not neutralized by type-specific serum will arise. An alternative approach is to prepare vaccines based on antigenic sites shared among all serotype and subtype viruses.

Adjuvants, Immunologic↗
PubMed1983

Comparison of the major antigenic determinants of different serotypes of foot-and-mouth disease virus.

Complete nucleotide sequences which code for the capsid protein VP1 of two foot-and-mouth disease virus serotypes, O1Campos/Brazil/58 and C3Indaial/Brazil/71, have been determined. Ten available VP1 sequences (three serotype O, three serotype C, and four serotype A) were aligned and compared. Our evidence suggests that O1BFS/Britain/68 and O1K/Germany/66 are closely related to O1Campos/Brazil/58. Significant variations were observed between the nucleotide sequences of C3Indaial determined by two different laboratories. These differences are probably the result of virus adaptation and propagation in different laboratories. In one of the isolates (C3Biogen), a 13-base-pair stem and 13-base-pair loop structure is located in the 134-158 amino acid variable region. Isolates of different serotypes differ at two highly variable regions, amino acid positions 42-60 and 134-158, but isolates of the same serotype show major differences only in the variable region between amino acids 134 and 158. Since the remaining amino acid sequence of VP1 is highly conserved, we conclude that the 134-158 amino acid variable region is involved in subtype specificity, whereas both variable regions contribute to serotype differences.

Amino Acid Sequence↗
PubMed1981

Vitellogenin in Drosophila melanogaster: sequence of the yolk protein I gene and its flanking regions.

We have isolated recombinant DNA clones coding for female specific proteins from Drosophila melanogaster. By screening with 32P-(A)+RNA from male and female flies, respectively, we were able to isolate a set of 100 cDNA clones which showed a positive hybridization signal for RNA from female flies. These clones have been rescreened with RNA isolated from fat body of two day old male and female flies. We obtained four positive cDNA clones. Isolation of the corresponding genomic sequences, construction of the physical map and comparing it with the restriction maps published by Barnett et al. (1) led us to conclude that we had isolated the genes coding for two of the three known yolk protein precursors (vitellogenins), YP I and YP II. The sequence of the YP I gene was determined. It gives rise to a protein of 48 700 dalton MW which might be cleaved to a MW of 46 700 during transport. The coding sequence is interrupted by a single intron of 75 bases in length. The proposed leader sequence starts at a region homologous to six heat shock gene sequences at the site of initiation of transcription, suggesting the existence of an 11 bp cap specific consensus sequence for Drosophila melanogaster.

Animals↗
PubMed1981

Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flanked by start and stop codons which is consistent with the mode of biosynthesis of VP1 by post-translational processing of a polyprotein precursor.

Amino Acid Sequence↗
PubMed1981

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli.

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage lambda PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

Antigens, Viral↗
PubMed1979

Total synthesis of a tyrosine suppressor tRNA gene. XVIII. Biological activity and transcription, in vitro, of the cloned gene.

The chemically synthesized gene for Escherichia coli tyrosine suppressor tRNA has been joined to both plasmid (ColE1 ampr) and bacteriophage (Charon 3A) vector chromosomes after the latter had been digested with the restriction endonuclease EcoRI. Suppression of both bacterial (trpA, his, lacZ) and bacteriophage lambda amber mutations (Aam32, Bam1) has been demonstrated after transformation of E. coli with the recombinant DNA molecules carrying the synthetic suppressor tRNA gene. The cloned synthetic gene has been reisolated from the vector chromosomes after digestion of the latter with EcoRI restriction endonuclease and characterized in regard to its size and its ability to serve as a source of suppressor activity in further transformation experiments. This synthetic gene has also been shown to suppress bacterial amber mutations after it had been incorporated into the E. coli chromosome as part of a lambda prophage. Transcription, in vitro, of the cloned synthetic suppressor gene gave a product which, on treatment with a crude E. coli extract, afforded the tyrosine suppressor tRNA precursor. The latter was characterized by two-dimensional fingerprinting after digestion with T1-RNase. Exposure of the in vitro transcript to RNase P Selectively released the 41-nucleotide-long fragment characteristic of the 5'-end of the tRNA precursor. Thus, the nucleotide sequence of the cloned gene is accurate and its expression is controlled by its promoter.

Base Sequence↗
PubMed1978

A rho-dependent termination site in the gene coding for tyrosine tRNA su3 of Escherichia coli.

A set of partially overlapping DNA restriction fragments that support promoter-dependent transcription of the tRNATyr1 gene of Escherichia coli has been used to study site-specific termination in vitro. Transcription termination occurs at a specific site 224-226 nucleotides beyond the end of the structural gene and is completely dependent on rho-factor. Certain features of this site suggest differences from other termination sites previously studied. A role for specific sequence recognition is suggested.

Base Sequence↗
PubMed1976

Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.

Base Sequence↗