PubMed Health⌕ Search

Biomedical subjects

H Macdonald

Publications and source records attributed to H Macdonald.

At least 19 recordsLinked to original sources
PubMed2006

Association of PLOD1 polymorphisms with bone mineral density in a population-based study of women from the UK.

The PLOD1 gene is situated within a quantitative trait locus for regulation of bone mineral density (BMD) on chromosome 1p36 and is a strong functional candidate for the regulation of BMD and bone quality. PLOD1 encodes the enzyme procollagen-lysine, 2-oxoglutarate 5-dioxegenase (lysyl hydroxylase; EC 1.14.11.4), which catalyses the hydroxylation of lysine residues during the posttranslational modification of type I collagen, the major protein of bone. We investigated the role of PLOD1 as a genetic determinant of osteoporosis by studying two coding polymorphisms located in exon 3 of the PLOD1 gene in relation to BMD and bone loss in a population-based cohort of 678 Scottish women. We observed a significant association between lumbar spine (LS) BMD and a polymorphism at nucleotide 386 (G386A) of PLOD1, which results in an alanine-threonine amino acid change at codon 99 (A99T). Heterozygotes for G386A had significantly reduced LS-BMD when compared with the other genotype groups, and the difference remained significant after correcting for confounding factors. A similar association was observed between LS-BMD and a conservative polymorphism at position 385 (C385T), but this was in strong linkage disequilibrium (LD) with G386A. There was no evidence for an allele dose effect for either polymorphism, and the strongest association was observed in heterozygotes. No association was found between PLOD1 alleles and femoral-neck BMD or bone loss, but the hydroxylysylpyridinoline to lysylpyridinoline ratio was significantly increased in G386A heterozygotes compared with other genotype groups, suggesting a functional effect of this polymorphism on enzyme activity. Our findings show that heterozygosity for the A99T variant of PLOD1 is associated with reduced LS-BMD and an altered ratio of hydroxylysylpyridinoline to lysylpyridinoline. Whilst further studies will be required to confirm and extend these observations, our studies raise the possibility that A99T heterozygosity might affect lysyl hydroxylase function and regulate bone mass.

Bone Density↗
PubMed2004

General practitioners' concerns about childhood immunisation and suggestions for improving professional support and vaccine uptake.

In recent years childhood vaccination has been vigorously debated. Professional and parental confidence in the measles, mumps and rubella (MMR) vaccine in particular has been shaken, as reflected by its decreased uptake. A semi-structured postal questionnaire survey of general practitioners (GPs) working in the Highland region of Scotland was undertaken to assess their views on vaccination issues. A 73% response rate was achieved. Of respondents 28% expressed concerns about the possible side effects of MMR. Of GPs 98% thought it was 'likely' that the benefits of the DTP-Hib, polio and men C vaccines outweighed the possible risks. For the first and second doses of MMR 92% and 86%, respectively, believed this to be true. Approximately three quarters of GPs described themselves 'very confident' in discussing the DTP-Hib vaccine with parents, compared with 57% for MMR. Some respondents were misinformed regarding the adverse events associated with the MMR vaccine. There is professional concern about MMR. Initiatives to support GPs in promoting vaccination in order to improve immunisation rates are discussed.

Attitude of Health Personnel↗
PubMed2000

Overexpression of auxin-binding protein enhances the sensitivity of guard cells to auxin.

To explore the role of auxin-binding protein (ABP1) in planta, a number of transgenic tobacco (Nicotiana tabacum) lines were generated. The wild-type KDEL endoplasmic reticulum targeting signal was mutated to HDEL, another common retention sequence in plants, and to KEQL or KDELGL to compromise its activity. The auxin-binding kinetics of these forms of ABP1 were found to be similar to those of ABP1 purified from maize (Zea mays). To test for a physiological response mediated by auxin, intact guard cells of the transgenic plants were impaled with double-barreled microelectrodes, and auxin-dependent changes in K(+) currents were recorded under voltage clamp. Exogenous auxin affected inwardly and outwardly rectifying K(+) currents in a dose-dependent manner. Auxin sensitivity was markedly enhanced in all plants overexpressing ABP1, irrespective of the form present. Immunogold electron microscopy was used to investigate the localization of ABP1 in the transgenic plants. All forms were detected in the endoplasmic reticulum and the KEQL and KDELGL forms passed further across the Golgi stacks than KDEL and HDEL forms. However, neither electron microscopy nor silver-enhanced immunogold epipolarization microscopy revealed differences in cell surface ABP1 abundance for any of the plants, including control plants, which indicated that overexpression of ABP1 alone was sufficient to confer increased sensitivity to added auxin. Jones et al. ([1998] Science 282: 1114-1117) found increased cell expansion in transgenic plants overexpressing wild-type ABP1. Single cell recordings extend this observation, with the demonstration that the auxin sensitivity of guard cell K(+) currents is mediated, at least in part, by ABP1.

Blotting, Northern↗
PubMed2000

Crystallization and preliminary X-ray analysis of the auxin receptor ABP1.

Auxin-binding protein (ABP1) is an important receptor for the plant hormone auxin that is involved with many growth and developmental responses in plants. The maize ABP1 gene has been expressed in insect cells, purified and crystallized. Type II crystals are monoclinic, with two glycosylated homodimers in the asymmetric unit, and diffract to 1.9 A using synchrotron radiation.

Crystallization↗
PubMed1997

Obstetric complications in autism: consequences or causes of the condition?

OBJECTIVE: To determine whether and why obstetric complications are associated with autism. METHOD: Obstetric histories, obtained at maternal interview and coded as an optimality score (OS), were compared in two groups: 78 families containing an autistic proband (ICD-10 criteria) and 27 families containing a down syndrome (DS) proband. The OS was examined in relation to offspring diagnosis, proband characteristics, and familial loading for autism and its phenotypic variants. RESULTS: Autistic and DS probands had a significantly elevated OS compared with unaffected siblings, regardless of birth order position. The elevation was mainly due to an increase in mild as opposed to severe obstetric adversities. In autistic probands, the OS was best predicted by familial loading for autism and its phenotypic variants, but in the absence of this measure by the number of autistic symptoms. Among siblings of autistic probands affected with autism or its variants, the OS was best predicted by the probands' OS, and in its absence, by the measure of familial loading. In DS probands and siblings the OS was associated with increased maternal age, although this did not account for the OS elevation in DS probands. CONCLUSIONS: Rather than playing any principal etiological role, the obstetric adversities associated with autism either represent an epiphenomenon of the condition or derive from some shared risk factor(s).

Adolescent↗
PubMed1997

The defeat of Philip Morris' 'California Uniform Tobacco Control Act'.

OBJECTIVES: This paper describes the strategies used by Philip Morris and other tobacco companies to promote a California initiative (Proposition 188) preempting local control of tobacco and those used by public health groups to defeat the initiative. METHODS: Interviews with key informants were conducted, and the written record was reviewed. RESULTS: Tobacco companies nearly succeeded in passing Proposition 188 by presenting it as a pro-health measure that would prevent children from obtaining cigarettes and provide protection against secondhand smoke. Public health groups defeated it by highlighting tobacco industry backing. A private charitable foundation also played an innovative role by financing a non-partisan public education campaign. CONCLUSIONS: Public health forces must be alert to sophisticated efforts by the tobacco industry to enact preemptive state legislation by making it look like tobacco control legislation. The coalition structure that emerged in the "No on 188" campaign represents an effective model for future tobacco control activities. The new role of charitable foundations defined in the Proposition 188 campaign can be used in other public health issues.

California↗
PubMed1996

Protein retention in the endoplasmic reticulum of insect cells is not compromised by baculovirus infection.

High level expression of the major auxin-binding protein (ABP1) from maize (Zea mays L.) has been used to demonstrate that the machinery for retaining proteins in the endoplasmic reticulum (ER) of insect cells functions efficiently throughout the baculovirus infection cycle. Immunolocalization showed wild-type ABP1 (ABP1-KDEL) to be targeted to the lumen of the ER, in accordance with its signal peptide and carboxyterminal KDEL ER-retention signal. The protein accumulated in dilations of the ER, and none was detected at the cell surface. Immunoblotting of concentrated culture medium confirmed that ABP1-KDEL was not secreted at a detectable level. In contrast, when the carboxyterminus was mutated to KEQL, secretion of the baculovirus-expressed protein was readily detected. Immunolocalization and immunoblotting demonstrated that a high proportion of the ABP1-KEQL protein was secreted at the cell surface and into the culture medium. The data demonstrate that the ER of insect cells has a great capacity to retain proteins and that this property is largely unaffected by the cellular disruption caused by baculovirus replication.

Amino Acid Sequence↗
PubMed1996

Characterization of a strawberry gene for auxin-binding protein, and its expression in insect cells.

A gene encoding an auxin-binding protein (ABP1) was isolated from strawberry by screening a genomic library with an ABP1 cDNA from maize. It resembles ABP1 genes from other sources both in structure (four introns) and in the high level of homology of the deduced amino acid sequence of the mature protein encoded in exons 2-5. Exon 1, encoding mainly the non-conserved signal peptide, was identified by a reverse transcriptase-polymerase chain reaction (RT-PCR) technique. Northern analysis indicated that ABP1 transcript levels were low during fruit development, but transcripts were detected by RT PCR at all stages of receptacle swelling (auxin-dependent) and ripening (inhibited by auxin), consistent with a role for ABP1 in auxin perception. Southern blot analysis indicated a small ABP1 gene family in octoploid cultivated strawberry, and four genes were identified by comparison of genomic and cDNA sequences. RT PCR was used to amplify the complete coding region for cloning as cDNA, and a recombinant baculovirus was constructed for the expression of strawberry ABP1 in insect cells. The coding region contains three consensus glycosylation sites, and multiple bands representing a range of glycoforms of the protein were detected on western blots of insect cell extracts. Only a single band was observed in extracts of tunicamycin-treated cells, and glycosylated protein yielded a unique N-terminal amino acid sequence, allowing determination of the signal peptide cleavage site.

Amino Acid Sequence↗
PubMed1996

Invasive cervical cancer in Southampton and South West Hampshire: effect of introducing a comprehensive screening programme.

A study of invasive cervical cancer in Southampton and South West Hampshire is reported, covering three consecutive three year periods during which the screening coverage increased from an estimated 60% to a recorded 87% of eligible women aged 20-64. From the first to the third periods of the study in that age group registrations of fully invasive squamous cell carcinoma (stage lb and above) fell from 64 to 30 (53%), which was largely counteracted by an increase in microinvasive squamous cell carcinoma (linear trend: P<0.0001). In the same age group registrations of adenocarcinoma rose slightly, which resulted from an increase in the number diagnosed at a depth of invasion of less than 3 mm. There were no significant changes in the numbers of stage III and IV cancers or among cancers in women aged 65 and over. A strong inverse association was found between stage of both histological types of cancer and their likelihood of being screen detected rather than symptomatic: 91% of screen detected cancers were diagnosed at stage I compared with 38% of symptomatic cancers. There was a slight downward trend in the incidence of cancer per 100,000 total female population across the three periods of the study with a significant trend towards low stage disease, which is likely to reduce mortality in years to come. The trend towards screen detected cancers and cancers of less than 3 mm depth of invasion is presented as a positive outcome to be expected in early rounds of increasing the screening coverage.

Adenocarcinoma↗
PubMed1995

Stable expression of maize auxin-binding protein in insect cell lines.

To achieve continuous expression of the major maize auxin-binding protein (ABP1) in insect cells, the ABP1 gene coding region was placed under control of a baculovirus immediate-early gene promoter and transfected into Spodoptera frugiperda Sf9 cells. The ABP1 gene was detected in twelve cell lines, one of which was selected for detailed analysis. Immunolocalisation demonstrated that ABP1 was targeted to and retained in the endoplasmic reticulum (ER), in accordance with its signal peptide and carboxy-terminal KDEL ER-retention signal. We discuss the advantages of stable-transformation over transient expression systems for characterising proteins targeted to the secretory system of insect cells.

Animals↗
PubMed1995

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Amino Acid Sequence↗
PubMed1995

Latent-class analysis of recurrence risks for complex phenotypes with selection and measurement error: a twin and family history study of autism.

The use of the family history method to examine the pattern of recurrence risks for complex disorders such as autism is not straightforward. Problems such as uncertain phenotypic definition, unreliable measurement with increased error rates for more distant relatives, and selection due to reduced fertility all complicate the estimation of risk ratios. Using data from a recent family history study of autism, and a similar study of twins, this paper shows how a latent-class approach can be used to tackle these problems. New findings are presented supporting a multiple-locus model of inheritance, with three loci giving the best fit.

Autistic Disorder↗
PubMed1994

Authentic processing and targeting of active maize auxin-binding protein in the baculovirus expression system.

The major auxin-binding protein (ABP1) from maize (Zea mays L.) has been expressed in insect cells using the baculovirus expression system. The recombinant protein can be readily detected in total insect cell lysates by Coomassie blue staining on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Our data suggest that ABP1 is processed similarly in both insect cells and maize. The signal peptide is cleaved at the same position as in maize and the mature protein undergoes tunicamycin-sensitive glycosylation, yielding a product with the same mobility on SDS-PAGE as authentic maize ABP1. On immunoblots the expressed protein is recognized by anti-KDEL monoclonal antibodies. Immunofluorescence localization demonstrates that it is targeted to and retained in the endoplasmic reticulum of insect cells in accordance with its signal peptide and KDEL retention sequence. The expressed ABP1 also appears to be active, since extracts of insect cells expressing ABP1 contain a saturable high-affinity 1-naphthylacetic acid-binding site, whereas no saturable auxin-binding activity is detected in extracts from control cells.

Amino Acid Sequence↗
PubMed1994

A case-control family history study of autism.

Family history data on 99 autistic and 36 Down's syndrome probands are reported. They confirmed a raised familial loading for both autism and more broadly defined pervasive developmental disorders in siblings (2.9% and 2.9%, respectively, vs 0% in the Down's group) and also evidence for the familial aggregation of a lesser variant of autism, comprising more subtle communication/social impairments or stereotypic behaviours, but not mental retardation alone. Between 12.4 and 20.4% of the autism siblings and 1.6% and 3.2% of the Down's siblings exhibited this lesser variant, depending on the stringency of its definition. Amongst autistic probands with speech, various features of their disorder (increased number of autistic symptoms; reduced verbal and performance ability) as well as a history of obstetric complications, indexed an elevation in familial loading. No such association was seen in the probands without speech, even though familial loading for the lesser variant in this subgroup, was significantly higher than in the Down's controls. The findings suggest that the autism phenotype extends beyond autism as traditionally diagnosed; that aetiology involves several genes; that autism is genetically heterogeneous; and that obstetric abnormalities in autistic subjects may derive from abnormality in the foetus.

Adolescent↗
PubMed1993

A soluble auxin-binding protein from Hyoscyamus muticus is a glutathione S-transferase.

We have used the photoaffinity label azido-[3H]IAA (5-N3-[7-3H]indole-3-acetic acid), a biologically active analog of indole-3-acetic acid, to identify auxin-binding proteins (ABPs) in the soluble fraction of Hyoscyamus muticus. A 25-kD polypeptide previously described (H. Macdonald, A. M. Jones, P. J. King [1991] J Biol Chem 266: 7393-7399) has now been purified to homogeneity by conventional methods. Binding of azido-[3H]IAA to the purified protein was reduced by active auxins but not by inactive indoles. Partial amino acid sequences of the purified protein showed high homology to glutathione S-transferase (GST) from tobacco (ParB) and from maize (GT32). The conclusion that the 25-kD ABP is a GST is further supported by high GST activity in fractions highly enriched in the 25-kD polypeptide and recognition of the ABP by antibodies against GST from wheat and maize. Furthermore, purification of a protein from a soluble protein extract from H. muticus by affinity chromatography on glutathione-agarose also yielded a 25-kD polypeptide that was indistinguishable in its N-terminal amino acid sequence and biochemical characteristics from the protein purified by conventional methods. Possible functions of GST in auxin action are discussed.

Amino Acid Sequence↗
PubMed1992

Season of birth: issues, approaches and findings for autism.

Rates of birth in the general population show seasonal fluctuations for reasons that are ill understood. Variations from these general population patterns have been reported for several psychiatric conditions and used as the basis for aetiological hypotheses. In this paper, the evidence for alterations in the expected seasonal fluctuation in birth dates of autistic people is evaluated. A national sample of 1435 autistic individuals and a clinic sample of 196 subjects are compared to general population figures and to 121 sibling controls. Compared with the general population, the national sample showed significant deviations from the expected rate of birth by month. In the clinic sample, differences from the anticipated monthly pattern were only evident when this sample was compared to the sibling controls. A variety of models for seasonal trends, including year quarters, temperature and sine wave forms, were fitted to these variations but no consistent picture emerged.

Adolescent↗
PubMed1991

Photoaffinity labeling of soluble auxin-binding proteins.

The photoaffinity labeling agent azido-IAA (5-N3-[7-3H]indole-3-acetic acid), a biologically active analogue of the endogenous auxin indole-3-acetic acid, was used to search for auxin-binding proteins in the soluble fraction of Hyoscyamus muticus cells. Azido-IAA became covalently attached to three polypeptides with a high specific activity. The labeling was specific for IAA and not due to random tagging. Two polypeptides with molecular masses of 31 and 24 kDa in the 0-30% ammonium sulfate fraction were labeled after UV photolysis at 0 degree C but not at -196 degrees C, and appeared to have a high affinity indole-binding site(s) for which active, non-indole auxins were not good ligands. A third polypeptide with a molecular mass of 25 kDa present in the 50-60% ammonium sulfate fraction labeled exclusively at -196 degrees C and had a significant affinity for active auxins but not for inactive indoles. The azido-IAA labeling pattern, pI, competition results, and immunoprecipitation all indicate that the 31- and 24-kDa polypeptides are related to the basic form of endo-1,3-beta-glucanase (EC 3.2.1.39). Azido-IAA labeling polypeptides equivalent to the 31- and 24-kDa species were apparently also present in the cell wall. The low pH optimum for binding of azido-IAA to the 25-kDa polypeptide suggests the location of the active protein in a compartment such as the vacuole or a transport vesicle rather than in the cytosol.

Affinity Labels↗