PubMed Health⌕ Search

Biomedical subjects

H Naora

Publications and source records attributed to H Naora.

At least 55 records · Page 3Linked to original sources
PubMed1989

Plasticity of DNA conformation around the Drosophila melanogaster alcohol dehydrogenase gene under torsional stress.

Genomic DNA of eukaryotes is thought to be organized into multiple topological domains whose conformation can be independently regulated by torsional stress. We have demonstrated the formation of altered DNA structures around the Drosophila melanogaster alcohol dehydrogenase (Adh) gene by sensitivity to endonucleases and by binding single-strand binding (SSB) protein. Several altered DNA structures were detected only on torsionally stressed DNA at specific sites. Some corresponded to the two initiation cap sites and the poly(A) addition sites and others were found in the 5'-flanking regions of both the adult and larval cap sites and in the 3'-flanking region of the Adh gene. In particular, the 5'-flanking regions both exhibited a plasticity of DNA conformation according to the strength of torsional stress and the concentration of Mg2+. SSB protein bound preferentially to the non-coding regions of the Adh gene only on torsionally stressed DNA and not on relaxed or linear DNA. The observed binding preference appeared to correspond to the thermodynamic stability of the base-pairs involved. These results suggest that DNA conformation is specifically organized around the Adh gene for gene function. The plasticity of DNA may play a role in the regulation of transcriptional activation.

Alcohol Dehydrogenase↗
PubMed1989

Light response of cultured melanophores of a freshwater teleost, Zacco temmincki.

Melanophores in the skin of the freshwater teleost Zacco temmincki are light sensitive: Melanin granules, melanosomes, in the melanophores aggregate in darkness and disperse in light. Cultured melanophores of Zacco temmincki exhibited light sensitivity in the same manner as the melanophores in isolated scales. The dark-induced aggregation response became conspicuous after 2 days in culture. The appearance of the light response was later than that of the response to norepinephrine or melatonin, which induced rapid melanosome aggregation at one day in culture. The light sensitivity of the melanophores in isolated scales differed between individuals. A high correlation was observed between the degree of dark-induced aggregation in scale melanophores and that in cultured ones.

Animals↗
PubMed1988

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA).

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.

Animals↗
PubMed1988

Spectral sensitivity of melanophores of a freshwater teleost, Zacco temmincki.

1. The melanophores of a freshwater teleost, Zacco temmincki, responded to changes in illumination: in darkness the melanophores induced a melanosome aggregation and when subjected to light they caused a melanosome dispersion. 2. Using monochromatic light, the spectral sensitivity of the melanophores was examined. 3. The melanophores showed a different sensitivity to light between 400 and 600 nm with a maximum at about 525 nm. 4. The action spectrum closely resembled a porphyropsin absorbance curve, suggesting a porphyropsin or similar photopigment is active in the melanophore light response of Zacco temmincki.

Animals↗
PubMed1987

Origin of noncoding DNA sequences: molecular fossils of genome evolution.

The total amount of noncoding sequences on chromosomes of contemporary organisms varies significantly from species to species. We propose a hypothesis for the origin of these noncoding sequences that assumes that (i) an approximately equal to 0.55-kilobase (kb)-long reading frame composed the primordial gene and (ii) a 20-kb-long single-stranded polynucleotide is the longest molecule (as a genome) that was polymerized at random and without a specific template in the primordial soup/cell. The statistical distribution of stop codons allows examination of the probability of generating reading frames of approximately equal to 0.55 kb in this primordial polynucleotide. This analysis reveals that with three stop codons, a run of at least 0.55-kb equivalent length of nonstop codons would occur in 4.6% of 20-kb-long polynucleotide molecules. We attempt to estimate the total amount of noncoding sequences that would be present on the chromosomes of contemporary species assuming that present-day chromosomes retain the prototype primordial genome structure. Theoretical estimates thus obtained for most eukaryotes do not differ significantly from those reported for these specific organisms, with only a few exceptions. Furthermore, analysis of possible stop-codon distributions suggests that life on earth would not exist, at least in its present form, had two or four stop codons been selected early in evolution.

Animals↗
PubMed1986

Human cellular sequences detectable with adenovirus probes. I. Evidence for novel repeat sequences and a possible E1a-like cellular "gene".

Previous studies suggesting homology between human cellular DNA and the DNAs from adenovirus types 2 and 5 are extended in the present paper. A clone (ChAdh), isolated from a human genomic DNA library using an adenovirus probe, hybridized to discrete regions of adenovirus 2 DNA, including part of the transforming genes E1a and E1b, as well as to repeated sequences within human DNA. The E1a and E1b genes both hybridize to the same 300 base pair Sau3AI fragment within ChAdh although there is no obvious homology between E1a and E1b. The Ad 2 E1a gene was also used as a probe to screen other cellular DNAs to determine whether repeated sequences detectable with Ad2 DNA probes were conserved over long evolutionary periods. Hybridization was detected to the genomes of man, rat, mouse and fruit fly, but not to those of yeast and bacteria. In addition to a "smear" hybridization, discrete fragments were detected in both rodent and fruit fly DNAs. The experiments reported suggest the existence of two different types of cellular sequences detected by Ad 2 DNA: (1) repeated sequences conserved in a variety of eukaryote genomes and (2) a possible unique sequence detected with an E1a probe different from that responsible for hybridization to repeated sequences. This unique sequence was detected as an EcoRI fragment in mouse DNA and had a molecular size of about 8.8 kb.

Adenoviruses, Human↗
PubMed1986

Altered regulation of c-myc expression in adenovirus-transformed cells.

Expression of the oncogenes c-myc, c-raski, and p53 is studied in normal primary mouse cultures and in two adenovirus-transformed mouse cell lines. In all cases oncogene expression is measured in cells arrested in G1 (or G0 for primary cells) by serum starvation and at different times after cell cycle traverse is stimulated by addition of high serum. For primary mouse cells, c-myc mRNA levels are found to increase four- to six-fold within 1 h of serum addition and then decline by 4 h to nearly the level observed in serum-starved cells. This level is maintained throughout the remainder of the cell cycle. The early induction of c-myc is dependent on serum concentration and is independent of cell density. These results confirm and extend previous observations for primary cells. By contrast, expression of c-raski does not vary at all through the cell cycle and p53 increases with time after mitogenic stimulation. In the adenovirus-transformed cell lines, the regulation of expression of c-myc with respect to the cell cycle is altered. There is an increase in c-myc in S phase cells which is dependent on cell density and the early induction in response to serum addition as seen in primary cells is absent. Expressions of c-raski and p53 are found to show similar profiles to those observed for primary cells.

Adenoviridae↗
PubMed1985

A monoclonal antibody against human urokinase: the epitope structure and sequence homology with a human tissue-type plasminogen activator.

Our previous study showed that an epitope defined by a monoclonal antibody against human urokinase is located on the 33-Kdalton catalytic domain of the enzyme (Nakamura, M. et al., Cell Struct Funct., 9, 167-179, 1984). The epitope structure was further determined and characterized on one-dimensional SDS-polyacrylamide slab gel maps of CNBr-cleaved polypeptide fragments as well as on their Western blots. A single homogeneous polypeptide with an approximate molecular weight of 3.4-Kdaltons was found to be antigenic. The monoclonal antibody exhibited a stronger inhibition of the enzyme activity than the polyclonal antibodies tested, and cross-reacted with a 65-Kdalton tissue-type plasminogen activator present in Detroit 562 cells. From these results and data made up with the help of a computer comparison of known sequences of urokinase and a tissue-type plasminogen activator, we concluded that the epitope is Cys-Gln-Gly-Asp-Ser-Gly-Gly-Pro-Leu-Val-Cys and contains a catalytically active residue, serine.

Amino Acid Sequence↗
PubMed1985

Homology of kringle structures in urokinase and tissue-type plasminogen activator: the phylogeny with the related serine proteases.

Twelve amino acid sequences of kringle-forming polypeptides were compiled from the known sequences of urokinase A-chain (human), a tissue-type plasminogen activator (human), prothrombin (human and bovine), and plasminogen (human). Their sequence homologies with maximum match were examined by a computer program. A homology alignment and graphic matrix analyses did show that they had a great degree of homology. All the cysteine residues responsible for the kringle structures of urokinase and the tissue-type plasminogen activator were confidently preserved as well as other proteins. A phylogenetic tree was then reconstructed, and the A- and S-chain of bovine and human prothrombins were accounted for the measurement of the evolutionary time span. It was found that urokinase had a larger time span, as much as 60 million years (MY), than the tissue-type plasminogen activator. A common ancestral element of the kringle-related serine proteases was placed at around 500 MY ago, as old as the diversion of the alpha- and beta-chains of hemoglobin. Thus, the kringle-families have undergone a substantial evolutionary divergence. Moreover, they can be subgrouped into three subfamilies: plasminogen activators, plasminogen, and prothrombin A-chains, the last being the most distantly diverged prothrombin S-chains.

Amino Acid Sequence↗
PubMed1984

Adenoviruses have homology with a reiterated sequence in genomic DNA.

The DNAs of human adenovirus types 2 and 5 (Ad2, Ad5) hybridize to genomic DNAs from human and chicken tissue. The pattern of Southern blot hybridization to genomic DNA digested with Eco RI suggests that sequences homologous to cloned Ad2 DNA are reiterated in genomic DNA. This was confirmed by liquid hybridization which shows that the hybrids have a low C0t 1/2 value. Finally, we show that total genomic human DNA probes hybridize to short fragments of adenoviral DNA in early-region genes near the ends of the viral genome.

Adenoviruses, Human↗
PubMed1984

A monoclonal antibody against human urokinase: characterization of the epitope and its localization in human kidney.

Monoclonal antibodies against human plasminogen activator urokinase have been produced. A G62 hybridoma-producing antibody (IgG) was purified on a DEAE-cellulose column, and it proved useful for the measurement, identification and purification of antigens that had approximate molecular weights of 55- and 33-Kdaltons. For immunochemical measurements and purification, a competitive enzyme-linked immunosorbent assay (ELISA) and affinity chromatography using antibody-immobilized Sepharose 4B were developed. The ELISA has sensitivity to 20 p mole antigen molecules. The binding capacity of the antigen on the affinity column was evaluated on SDS-polyacrylamide slab gels as well as by fibrin autography and ELISA. Results showed that there was quantitative purification with no loss of enzyme activity in the one-step procedure. Western blotting and affinity binding showed antigenic bands with apparent molecular weights of 55- and 33-Kdaltons. Because the 55-Kdalton form contains 33- and 22-Kdalton components connected by a disulfide bond, the epitope domain is present on the 33-Kdalton chain. Using this antibody, we examined human kidney sections by direct immunofluorescence to locate the antigen. It was found in epithelial cells convoluted segments, in glomerulus cells and in capillary endothelial cells, evidence that renal tubular cells synthesize the antigen which then is secreted in urine.

Animals↗
PubMed1983

A small chromatin-associated RNA homologous to repetitive DNA sequences.

The chromatins of rat liver and chicken reticulocytes contain a small RNA of identical length (29 nucleotides). This RNA species differs from the degradation products of nuclear RNA present in the chromatin in possessing a free 3'-hydroxyl terminus. It stays associated with chromatin and is not released from the nuclei during the extraction of nuclear ribonucleoprotein particles. This RNA species was purified from the third fraction of non-histone chromosomal proteins eluted from Sephadex G-200 (fraction 3 RNA). When fraction 3 RNA, isolated from rat liver, was used to screen a rat genomic library approximately 3% of the phage plaques hybridized with the RNA. DNA isolated from four randomly selected hybridizing phage clones hybridized with purified 29-nucleotide RNA demonstrating that the sequences present in the four clones represent those of the 29-nucleotide RNA species and not those of minor contaminants. Each of the four clones contained a different amount of sequences complementary to the RNA species 29-nucleotides-long and in each clone the DNA sequences homologous to this RNA were surrounded by different restriction sites. Hybridization of 3'-32P-labeled fraction 3 RNA with blots of total genomic DNA established that some sequences homologous to this RNA are dispersed in the DNA and others are present on one EcoRI restriction fragment, which is approximately 6000 base pairs long. Fraction 3 RNA is not a degradation product of ribosomal or transfer RNA, it is transcribed from middle repetitive DNA and probably originates by specific release during the formation and/or processing of high-molecular-weight transcripts. In normal liver cells its sequences are not released into the cytoplasm.

Animals↗
PubMed1982

Relationship between the total size of exons and introns in protein-coding genes of higher eukaryotes.

We have attempted to ascertain the correlation between the genetic information content in the exons and the surrounding intron sequences with regard to their spatial arrangement within a gene. A comparison is made of the sizes, taken from recent publications, of exons and introns of approximately equal to 80 different protein-coding chromosomal genes, mostly from higher eukaryotes. The exons of these genes do not show very marked variation in size and can be classified into three major discrete and two minor additional size groups, whereas individual introns vary considerably in size within and between genes. Notwithstanding, the overall length of all introns present within a given gene is a function of the total size, mostly corresponding to the total genetic information content, of the exons. Three cases that violate this exon-size dependency of introns are genes coding for (i) histone H1, feather keratin, and interferons, (ii) tubulin and actin, and (iii) silk fibroin. The exons of these genes are larger than 0.7 kilobase pair in total size and the genes show a strong sequence homogeneity among the repetitious family members or internal repeats of coding sequences within the gene. We propose that conservation of sequences, which is required by the family members, internal repeats, or the entire gene, would actually motivate the removal of introns.

Animals↗