PubMed Health⌕ Search

Biomedical subjects

H O Hallander

Publications and source records attributed to H O Hallander.

At least 37 records · Page 2Linked to original sources
PubMed1995

Atypical mycobacteria in extrapulmonary disease among children. Incidence in Sweden from 1969 to 1990, related to changing BCG-vaccination coverage.

SETTING: In April 1975, the general BCG vaccination of newborns in Sweden was replaced by selective vaccination of groups at increased risk of tuberculosis. OBJECTIVE: To relate the incidence of atypical mycobacterial disease in children to BCG vaccination. DESIGN: A nationwide survey in Sweden during the period 1969-90 disclosed 390 children under 15 years of age with bacteriologically confirmed atypical mycobacteria from extrapulmonary lesions. RESULTS: The average, annual incidence of atypical mycobacterial disease per 100,000 children under 5 years of age increased from 0.06 during the period 1969-74 to a maximum level of 5.7 during 1981-85. Among the cohorts born in Sweden in the period 1975-85, the cumulative incidence rate before 5 years of age was estimated at 26.8 per 100,000 non-BCG-vaccinated children and at 4.6 among those BCG-vaccinated, ratio 5.9 (95% confidence limits 1.6, 48.5). Mycobacterium avium-intracellulare was found in 83%. Disseminated, fatal disease developed in 3 children. The remaining ones suffered from local infections, most often lymph-node or soft-tissue lesions. The observed incidence of bacteriologically confirmed diagnosis was estimated to represent approximately 40% of the 'true' number, if patients with diagnosis based on histological, clinical and epidemiological findings only were included. CONCLUSION: The present study indicates that BCG vaccination plays a role in protection against localized disease caused by atypical mycobacteria in children.

Adolescent↗
PubMed1993

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Base Sequence↗
PubMed1993

Comparison of nasopharyngeal aspirates with swabs for culture of Bordetella pertussis.

Nasopharyngeal samples were collected from 117 children by aspiration from one nostril and by swab from the other one and cultured for Bordetella pertussis. Among 33 culture-positive specimens, there were 30 positive aspirates and 26 positive swab specimens. Aspirates are easily divided and saved for investigations with other assays which may further improve diagnostic sensitivity. As the aspiration technique was also preferred by nurses and parents, it was recommended and chosen for a planned pertussis vaccine efficacy trial to take place in Sweden from 1992 to 1995.

Adolescent↗
PubMed1992

Pertussis antibodies, protection, and vaccine efficacy after household exposure.

During a randomized trial of a cellular pertussis vaccines, significantly fewer recipients of a two-component vaccine (Japanese National Institute of Health [JNIH]-6) were diagnosed as primary or coprimary cases in households than either placebo recipients or those who received a monocomponent pertussis toxoid vaccine (JNIH-7). After household exposure to a culture-confirmed primary case, efficacy for JNIH-6 was estimated to be 35% (95% confidence interval, -14% to 57%) against any culture-confirmed disease and 58% (95% confidence interval, -6% to 84%) against clinical disease with 21 days or more of coughing spasms. The corresponding efficacy estimates for JNIH-7 were 67% (95% confidence interval, 32% to 80%) and 82% (95% confidence interval, 41% to 96%). Differences between the JNIH-6 and JNIH-7 vaccines in efficacy after household exposure were not statistically significant. No association could be established between protection against pertussis after household exposure and serum levels of IgG antibody to pertussis toxin or filamentous hemagglutinin in vaccinated individuals, in either study children or other household members.

Adolescent↗
PubMed1992

The impact of changing BCG coverage on tuberculosis incidence in Swedish-born children between 1969 and 1989.

In April 1975, the mass vaccination of newborns against tuberculosis was replaced by selective vaccination of groups at risk. BCG coverage fell from more than 95% before 1974 to 1.8% between 1975 and 1982 and thereafter reached an average of 13.7% up to 1989. The cumulative incidence of tuberculosis before 5 years of age was estimated among children born in Sweden during periods of high, low and moderate increasing BCG coverage. The incidence figures per 100,000 children was 0.8, 3.9 and 2.9, respectively, for children born to Swedish parents and 2.6, 39.4 and 13.2, respectively, for those born to foreign parents. The observed incidence of tuberculosis among non-BCG vaccinated children born to Swedish parents was within the expected limits given by a prognostic model based on the natural change of the risk of infection. The effectiveness of the selective BCG vaccination programme, which was intensified after 1981 for the second generation of immigrants, was estimated to 0.82 (95% confidence interval 0.38, 0.95) assuming that there was no change of the risk of infection for children born to foreign parents over the period studied. From April 1975 to December 1989, tuberculosis was notified in 85 children born in Sweden during the same period, 7 of them were BCG vaccinated and 78 non-vaccinated, 45 were symptomatic, 3 of them with disseminated tuberculosis.

Adolescent↗
PubMed1991

Acellular pertussis vaccines. Efficacy and evaluation of clinical case definitions.

The efficacy of two acellular pertussis vaccines was estimated for various clinical case definitions, with and without the requirement of culture confirmation, from a randomized trial in Sweden. Efficacy increased with duration of coughing spasms and when the case definition included whoops or whoops plus at least nine coughing spasms a day. After deletion of clinical cases not believed to be caused by pertussis, efficacies were closer to the higher values for culture-confirmed disease. Nonspecificity of the clinical criterion "21 days of coughing spasms with whoops" resulted in estimates of predictive value for pertussis of 85% for placebo recipients and 56% for vaccinees. We conclude that laboratory confirmation of suspected cases is needed in pertussis vaccine trials. A suggested case definition is 21 days or more of coughing spasms with confirmation by culture, serologic study, or household exposure to culture-confirmed pertussis.

Humans↗
PubMed1991

Evaluation of the adenosine triphosphate test in the diagnosis of urinary tract infection.

Determination by bioluminescence of the bacterial adenosine triphosphate (ATP) level in urine was evaluated as a method for detection of bacteriuria in 1126 women with symptoms of UTI and 530 attending for follow-up. Conventional urine culture was used as reference method. The criterion for bacteriuria was growth of greater than or equal to 10(5) cfu/ml, giving a prevalence of 0.60. ATP levels of less than 10 nmol/l and greater than 50 mmol/l indicated abacteriuria and bacteruiria, respectively, whereas intermediate concentrations required culture if the nitrite test was negative. With this diagnostic strategy the sensitivity and specificity was 0.96 and 0.90 at the first visit and 0.90 and 0.98 at follow-up. With some methodological improvement the ATP test could be useful in medium-sized and small laboratories.

Adenosine Triphosphate↗
PubMed1991

Evaluation of serology and nasopharyngeal cultures for diagnosis of pertussis in a vaccine efficacy trial.

Nasopharyngeal cultures and titer rises in paired sera were evaluated in a placebo-controlled pertussis vaccine efficacy trial. IgG ELISA for filamentous hemagglutinin (FHA) identified 30 (88%) of 34 placebo recipients and 33 (89%) of 37 vaccine recipients with culture-verified Bordetella pertussis infections, whereas IgG ELISA for pertussis toxin (PT) showed higher diagnostic sensitivity in the placebo group than in the vaccine groups. The CHO cell assay did not improve sensitivity. Children with Bordetella parapertussis infections had rises of titers of antibody to FHA of the same magnitude as children with B. pertussis infections. Sensitive serologic criteria, based on the intraassay variations, identified 105 additional culture-negative cases with significant titer rises in paired sera. IgG ELISA for FHA and PT and IgA ELISA for FHA were reliable assays, and bacterial isolation rates were lower in vaccine recipients than in placebo recipients with serologically defined pertussis.

Antibodies, Bacterial↗
PubMed1990

A DNA hybridization test for detection of Bordetella in nasopharyngeal specimens.

A cloned Bam H1 fragment of genomic Bordetella pertussis DNA which recognized a frequently repeated sequence in the genome of B. pertussis was used as a probe in a DNA hybridization assay for the detection of Bordetella. Extensive studies on cross-reactivity were carried out in standardized strains and in cultured swab specimens from patients without suspected pertussis. Hybridizations of cultured clinical specimens from 142 patients with suspected pertussis were in complete agreement with the standard identification methods. The recovery rate of B. pertussis from nasopharyngeal swabs was less than 50%. Therefore the possibility to detect low numbers of B. pertussis in solution (nasopharyngeal aspirates) was investigated. The detection limit of direct hybridization by dot-blot technique was 5 x 10(3)-10(4) B. pertussis. Culturing bacteria on membranes placed on agar plates prior to hybridization showed that the detection limit could be lowered to 10(4), 10(2), and 10(1) cfu after 1, 2 and 3 days' culture, respectively. DNA hybridization under these conditions was found to be sufficiently sensitive and specific for further evaluation in clinical specimens for diagnosis of pertussis.

Bacteriological Techniques↗
PubMed1990

Efficacy of single-dose versus seven-day trimethoprim treatment of cystitis in women: a randomized double-blind study.

Single-dose trimethoprim treatment of cystitis was compared with 7-day treatment in a randomized double-blind study in primary health care. Consecutive female patients (613) with symptoms of lower urinary tract infection (UTI) and positive bacteriuria screening tests were enrolled. In 502 cases UTI was confirmed by urine culture. Follow-up was performed twice, after 2-3 and 5-6 weeks. Short-term efficacy could be evaluated in 425 cases and accumulated efficacy in 344. Short-term efficacy was 82% for single-dose and 94% for 7-day treatment (P less than .001). Accumulated efficacy was 71% for single-dose and 87% for 7-day therapy (P less than .001). Fewer adverse reactions were noted with single-dose therapy (not significant). The cure rate for UTI caused by P-fimbriated Escherichia coli was not different from that of other E. coli infections. Infections with Staphylococcus saprophyticus showed a lower cure rate than E. coli infections with the single-dose regimen (P less than .05 for short-term efficacy).

Adolescent↗
PubMed1990

Female urinary tract infection in primary health care: bacteriological and clinical characteristics.

Female patients with symptoms of urinary tract infection (n = 1136) were studied in primary health care with respect to (a) clinical symptoms as predictors of bacteriuria; (b) relation between aetiological agent and clinical picture, especially for P-fimbriated Escherichia coli; and (c) clinical findings in cases with 10(2)- less than 10(5) CFU/ml of E. coli. Prevalence of bacteriuria (greater than or equal to 10(5) CFU/ml) was 61%. Concurrence of urgency/frequency and dysuria, short duration of symptoms and hematuria increased the probability of bacteriuria and were also significantly more frequent among cases with low counts of E. coli (10(2) less than 10(5) CFU/ml in pure culture or mixed flora) than among cases with sterile urine, indicating an aetiological role of E. coli in many of those cases. Infections with P-fimbriated E. coli were as benign as the P-fimbriae-negative. The rate of P-fimbriation was 29% in specimens containing greater than or equal to 10(5) CFU/ml of E. coli, 30% among specimens with less than 10(5) CFU/ml in pure culture and 10% in specimens containing less than 10(5) CFU/ml of E. coli in mixed culture. Patients infected with Klebsiella, Enterobacter or Proteus did not show a higher rate of previous urinary tract disease or anomalies.

Adolescent↗
PubMed1988

Epidemiological typing of Corynebacterium diphtheriae isolated in Sweden 1984-1986.

From September 1984 to December 1986 121 cases of culture-positive diphtheria were reported to the National Bacteriological Laboratory in Stockholm. Toxigenic Corynebacterium diphtheriae nongravis was isolated from all but one of 33 patients with disease and from 69 healthy carriers. 63/65 toxigenic isolates, available for epidemiological typing, had the same phage type, 20, and the same restriction enzyme pattern, RE2. This included strains isolated both from patients inside and outside of the traditional risk groups of people abusing alcohol and drugs. Non-toxigenic strains gave different phage types and RE patterns.

Bacteriophage Typing↗
PubMed1988

In vitro comparison of the activity of doxycycline, tetracycline, erythromycin and a new macrolide, CP 62993, against Mycoplasma pneumoniae, Mycoplasma hominis and Ureaplasma urealyticum.

The in vitro activities of doxycycline, tetracycline, erythromycin and a new macrolide, CP 62993, against clinical isolates of Mycoplasma pneumoniae (n = 3), Mycoplasma hominis (n = 64) and Ureaplasma urealyticum (n = 33), were compared using an agar dilution method. M. pneumoniae seemed equally susceptible to the two tetracyclines, while the minimum inhibitory concentrations (MICs) of doxycycline were one or two dilution steps lower than the MICs of tetracycline for most strains of M. hominis and U. urealyticum. Ten of the 64 M. hominis strains required greater than or equal to 32 mg/l of tetracycline and 4 to 32 mg/l of doxycycline for inhibition. The MICs of CP 62993 were lower than those of erythromycin for all species tested although as much as 2 to 4 mg/l were required for inhibition of M. hominis. There is microbiological evidence that doxycycline as well as tetracycline might be effective against mycoplasmas and ureaplasmas. For erythromycin this is only true for M. pneumoniae and U. urealyticum.

Azithromycin↗
PubMed1986

Routine use of counterimmunoelectrophoresis for the detection of pneumococcal antigen in sputum.

Sputum samples obtained routinely for culture from patients at a thoracic department were also examined for pneumococcal antigen by means of counterimmunoelectrophoresis (CIE), using a polyvalent antipneumococcal type serum (omniserum). Pneumococci were found in 1.3% of the 880 cultures, whereas pneumococcal antigen was detected with CIE in 6.5%. The validity of these findings was tested by correlating them with the presence of clinical symptoms in those with positive tests and also by antigen detection in ELISA using monoclonal antibodies specific for the C-polysaccharide common to all types of pneumococci. Clinical findings corresponding to confirmed or probable current chest infection were found in 36 of the 48 patients with positive CIE. ELISA was positive in 33 of the 38 patients with positive CIE who were tested. Although the study deals with an unselected material of chest patients, it indicates that CIE is a sensitive method and that it is independent of current antibiotic treatment. Pneumococcal infection is probably of importance in exacerbations of chronic obstructive lung disease, but the clinical usefulness of detecting pneumococcal and other antigens in this patient group needs to be studied further.

Antibodies, Monoclonal↗
PubMed1986

Evaluation of rapid methods for the detection of bacteriuria (screening) in primary health care.

The diagnostic performance of six methods for bacteriuria testing has been studied in 781 urine specimens obtained in primary health care, using conventional culture as reference method. The cut-off limits for classification of test results into positive and negative have been optimized with respect to diagnostic performance in primary health care. With optimized tests the following diagnostic efficiencies were obtained: Bacterial ATP, 0.94; Bacterial count in sediment, 0.93; Nitrite test, 0.92; Dipslide test, 0.92; White cell count in sediment; 0.87; Goffulocyte esterase test; 0.83. The diagnostic performance was also studied for all combinations of two tests. The highest diagnostic efficiency (0.96) was obtained by combining the ATP and dipslide tests. High diagnostic efficiencies can be obtained by a rapid primary test, using other tests for follow-up testing of specimens with intermediate or uninterpretable primary results. The most promising results were obtained by using ATP as the primary test, with follow-up testing of specimens with 3-25 nmol/l of ATP (12 per cent of the specimens). Follow-up testing by conventional culture resulted in overall diagnostic efficiency of 0.98. By performing the nitrite test on specimens with intermediary ATP-results, 81 per cent of the patients with UTI can be classified without culture. Only patients with intermediary ATP and negative nitrite results (10 per cent of the total number) will have to wait for final diagnosis based on conventional culture. Some alternative strategies to combine available methods are discussed in detail. Major advantages of the ATP test are that the test can be performed while the patients are waiting; it provides a numerical and objective result, and, in contrast to culture, it is not influenced by adhesion of bacteria to somatic cells.

Adenosine Triphosphate↗