PubMed Health⌕ Search

Biomedical subjects

H P Agrawal

Publications and source records attributed to H P Agrawal.

12 recordsLinked to original sources
PubMed1985

12-O-tetradecanoylphorbol-13-acetate-induced rapid loss of persistent 7,12-dimethylbenz[a]anthracene-DNA adducts in mouse epidermis and dermis.

Twice-weekly application to mouse skin of 10 nmol of the potent tumor promoter, 12-O-tetradecanoylphorbol-13-acetate (TPA), beginning at 3 weeks after topical application of 1.2 mumol of 7,12-dimethylbenz[a]anthracene (DMBA), was found to cause a rapid loss of persistent DMBA-DNA adducts from both epidermal and dermal DNA. This effect is thought to reflect TPA-induced proliferation of quiescent initiated skin cells containing persistent adducts and may be causally related to the irreversibility of the initial phase of tumor promotion, which is known to require cell proliferation.

9,10-Dimethyl-1,2-benzanthracene↗
PubMed1985

32P-postlabeling analysis of DNA adducts persisting for up to 42 weeks in the skin, epidermis and dermis of mice treated topically with 7,12-dimethylbenz[a]anthracene.

The initial and persistent levels of 7,12-dimethylbenz[a]-anthracene (DMBA)-DNA adducts in mouse skin, epidermis and dermis after topical carcinogen application were studied by 32P-postlabeling assay. In the major experiment, a single dose of 1.2 mumol of the carcinogen was applied to the shaved backs of adult female BALB/cANN mice, and DNA was isolated from epidermis and dermis, respectively, 24 h and 1, 2, 3, 4, 8, 16, 24, 36 and 42 weeks later. Total binding at 24 h was approximately 34 and approximately 28 adducts in 10(7) normal nucleotides for epidermal and dermal DNA, respectively. (One adduct in 10(7) nucleotides equals 0.3 fmol adduct/microgram DNA.) While initial binding was higher in epidermal DNA, the adducts were approximately 10 times more persistent in dermal DNA: at 42 weeks, total binding levels were approximately 0.17 and approximately 1.7 adducts in 10(7) nucleotides for epidermis and dermis, respectively. To quantitate low levels of DMBA-DNA adducts, 32P-postlabeling assays were run in the presence of a limiting amount of carrier-free [gamma-32P]ATP; this was found to favor labeling of the adducts, thereby leading to a 20- to 100-fold enhancement of the method's sensitivity for individual adducts. One of the three major DMBA-DNA adducts was more persistent than were the others; the level of this adduct remained constant at approximately 60% of the total in epidermal and dermal DNA during the last 18 weeks of the 42-week observation period. Since a [3H]thymidine-labeling experiment showed a normal epidermal DNA turnover 40 weeks after DMBA treatment, it was concluded that the bulk of the persistent adducts was present in subpopulations of dormant cells. We have hypothesized that such cells, in the absence of a promoting stimulus, are incapable of division because of the adduction and/or mutation of genes critical for growth (proto-oncogenes), and may thus correspond to the 'latent tumor cells', as defined by Berenblum and Shubik in their classical analysis of the attributes of tumor initiation and promotion.

9,10-Dimethyl-1,2-benzanthracene↗
PubMed1985

Postlabeling methods for carcinogen-DNA adduct analysis.

Radioactive carcinogens have provided most of our present knowledge about the chemistry of interactions between carcinogens and biological systems. The requirement of radioactive carcinogens has restricted carcinogen-DNA binding studies to chemicals that are readily available in isotopically labeled form, i.e., a minute fraction of all potentially mutagenic or carcinogenic chemicals. To extend the scope of carcinogen-DNA binding studies, an alternative method, which does not require radioactive test chemicals, has been developed. In this approach, radioactivity (32P) is being incorporated into DNA constituents by polynucleotide kinase-catalyzed [32P]phosphate transfer from [gamma-32P]ATP after exposure of the DNA in vitro or in vivo to a nonradioactive, covalently binding chemical, and evidence for the alteration of DNA nucleotides is provided by the appearance of extra spots on autoradiograms of thin-layer chromatograms of digests of the chemically modified DNA. Quantitation of adduct levels is accomplished by scintillation counting. The sensitivity of the technique depends on the experimental conditions for 32P-labeling and on the chemical structure of the adducts. Greater sensitivity may be achieved if adducts can be separated as a class from the normal nucleotides. This is the case for an estimated 80% of all carcinogens, giving rise to bulky and/or aromatic substituents in DNA. Under the present conditions, one such adduct in 10(9) to 10(10) normal nucleotides can be detected. A total of approximately 80 compounds has been studied thus far Binding to DNA of rodent tissues was readily detected by the 32P-postlabeling assay for all known carcinogens among these compounds, and adducts were detected in DNA from human placenta of smokers.

Animals↗
PubMed1984

Specific lack of the hypermodified nucleoside, queuosine, in hepatoma mitochondrial aspartate transfer RNA and its possible biological significance.

Tumor nucleic acids have frequently been found to be deficient in methylated and other modified nucleotides. In particular, cytoplasmic transfer RNAs (tRNAs) from various neoplasms partially lack the hypermodified nucleoside queuosine, a modification specific for anticodons of histidine-, tyrosine-, asparagine-, and aspartic acid-accepting tRNAs. Using aspartate tRNA as an example, we show here that liver mitochondria contain tRNA fully modified with respect to queuosine, while the corresponding tRNA from mitochondria of Morris hepatoma 5123D completely lacks this constituent. The sequences of these tRNAs, which were determined by a highly sensitive 32P-postlabeling procedure entailing the direct identification of each position of the polynucleotide chains, were found to be (sequence in text) Lack of queuosine in the hepatoma mitochondrial tRNA may be due to the inavailability of queuine in the hepatoma mitochondria for incorporation into tRNA or to inhibition of the modifying enzyme, tRNA (guanine)-transglycosylase, in the tumor. Taking into account results of others indicating a possible involvement of the queuosine modification in differentiation of eukaryotic cells, we hypothesize that the queuosine defect may develop at an early stage of carcinogenesis (i.e., during the promotion phase) and be directly involved in abnormalities of mitochondria which have been observed frequently in transformed cells and tumors.

Animals↗
PubMed1984

Biochemical (postlabelling) methods for analysis of carcinogen-DNA adducts.

Radioactive carcinogens have provided most of our present knowledge about the interactions between carcinogens and components of biological systems. The requirement of radioactive carcinogens restricts carcinogen-DNA binding studies to chemicals that are readily available in isotopically labelled form, i.e., a minute fraction of all potentially mutagenic or carcinogenic chemicals. To extend the scope of carcinogen-DNA binding studies, an alternative method, which does not require radioactive test chemicals, has been developed. In this approach, radioactivity (32P) is incorporated into DNA constituents by polynucleotide kinase-catalysed (32P)-phosphate transfer from (gamma-32P)ATP after exposure of the DNA, in vitro or in vivo, to a nonradioactive, covalently binding chemical; alteration of DNA nucleotides is shown by the appearance of extra spots on autoradiograms from thin-layer chromatograms of digests of the chemically modified DNA. Adduct levels are quantitated by scintillation counting. The sensitivity of the technique depends, to some extent, on the chemical structure of the adducts, in that greater sensitivity is achieved if adducts can be separated, as a class, from the normal nucleotides. An estimated 80% of all carcinogens can be separated in this way, giving rise to bulky and/or aromatic substituents in DNA. Under present conditions, one such adduct in 10(9)-10(10) normal nucleotides can be detected. A total of 41 compounds has been studied, so far. Binding to DNA of rodent liver and skin was readily detected by the 32P-postlabelling assay for all known carcinogens among these compounds, and adducts were detected in DNA from tissues of smokers.

Aflatoxin B1↗
PubMed1983

tRNA alterations in cancer.

1. 3H-, 125I-, and 32P-labeling methods were developed for base composition and sequence analysis of minute amounts of nonradioactive nucleic acids containing modified constituents. 2. Base composition analysis showed tRNA from two "liver-like" minimal deviation hepatomas, Morris hepatomas 5123D and 7777, to exhibit typical alterations when compared with liver tRNA. Our observations, which were made for different transplant generations of the tumors, indicated a trend toward undermethylation and undermodification of tRNA. 3. Sequence analysis of several cytoplasmic and mitochondrial tRNAs from hepatoma 5123D showed partial lack of m2G and complete lack of Gm and Q. 4. Sequence analysis of mitochondrial tRNAs from hepatoma 5123D indicated several instances of alterations of primary structure, a phenomenon not previously observed for cytoplasmic tRNAs from neoplasms. 5. Biochemical mechanisms underlying these alterations, as well as their functional implications, have yet to be investigated. 6. Modification patterns, but not primary structures, of mitochondrial tRNAs have been highly conserved when compared to prokaryotic and eukaryotic cytoplasmic tRNAs. This implies that (a) post-transcriptional modifications must play a crucial role in tRNA function, and (b) alterations of post-transcriptional modifications in tumor tRNAs have to be regarded as highly significant deviations from the norm.

Animals↗
PubMed1983

Highly persistent polycyclic aromatic hydrocarbon-DNA adducts in mouse skin: detection by 32P-postlabeling analysis.

A 32P-postlabeling method for carcinogen-DNA adduct analysis recently developed in our laboratory was applied to skin DNA from mice treated topically with polycyclic aromatic hydrocarbons (PAHs). After application of 4 doses of 1.2 mumol each of benzo[alpha]pyrene (BP), 3-methylcholanthrene (MC) and 7,12-dimethylbenz[alpha]anthracene (DMBA), respectively, total covalent adduct binding in mouse skin DNA initially amounted to 1 adduct in 6.0 X 10(4) - 1.3 X 10(5) nucleotides. Four weeks after treatment, these levels had declined to 1 adduct in 1.4 X 10(6) - 2.7 X 10(6) nucleotides. Substantial removal of DNA adducts occurred during the first 2 weeks after carcinogen application while adducts remaining thereafter underwent little or no repair between 2 and 4 weeks after treatment. These results raise the possibility that the persistent adducts occupy specific genomic sites in quiescent cells where they may not be amenable to repair because of localized conformational alterations of DNA or shielding by associated proteins.

9,10-Dimethyl-1,2-benzanthracene↗
PubMed1981

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.

Animals↗
PubMed1981

Lack of a specific ribose methylation at guanosine 17 in Morris hepatoma 5123D tRNASer1IGA.

Tumor transfer RNA's (tRNA's) frequently exhibit alterations in column chromatographic profiles and in base compositions when compared to their normal counterparts. Because such alterations may be involved in the dedifferentiated state of cancer cells, it is of interest to determine their structural basis and functional significance. The recent development of highly sensitive postlabeling methods has now made possible sequence analysis of tRNA's from neoplastic tissues available only in limited amounts. We have determined the nucleotide sequence of Morris hepatoma serine tRNA (anticodon IGA) and compared it with its normal counterpart in rat liver. The tumor serine tRNA was found to lack the ribose methylation of guanosine in position 17 of the dihydrouridine loop present in the liver RNA. This result explains the column chromatographic shifts of Morris hepatoma 5123D seryl-tRNA isoacceptors, suggesting that all seryl-tRNA isoacceptors may lack this modification.

Animals↗