PubMed Health⌕ Search

Biomedical subjects

H Shi

Publications and source records attributed to H Shi.

At least 73 records · Page 4Linked to original sources

Central skull base invasion of maxillofacial tumors: computed tomography appearance.

OBJECTIVE: The aim of this study was to demonstrate computed tomography (CT) features of maxillofacial tumors invading the central skull base and to offer information in aiding diagnosis. METHODS: Fifty-eight maxillofacial tumors with central skull base invasion shown on axial and coronal CT images were divided into benign (13 cases) and malignant (45 cases) groups, based on their pathologic outcomes as proven by biopsy and surgery. RESULTS: Four manifestations of the skull base abnormality were observed on CT images: (1) resorption of central skull base (53 cases, 11 benign and 42 malignant tumors); (2) enlargement of the foramen and canal in the central skull base (20 cases, 4 benign and 16 malignant tumors); (3) thinning of the central skull base (11 cases, 8 benign and 3 malignant tumors); and (4) displacement of the central skull base (5 cases, all benign tumors). The following structures of the central skull base were involved: the roof of the pterygoid process of the sphenoid bone (49 cases), the sphenoid greater wing (37 cases), the sphenoid body and sinus (33 cases), the petrous apex (12 cases), the clivus (4 cases), and the articular surface of the temporal squama (3 cases). Of 58 patients, 30 (7 benign and 23 malignant) had tumors with central skull base erosion that infiltrated into the cranial cavity. CONCLUSION: Benign maxillofacial tumors with center skull base erosion tended to lead to the displacement and thinning of the base of the middle skull fossa in contrast with tumors with malignant maxillofacial tumors. It is believed that these CT manifestations might be valuable in making a differential diagnosis.

Adolescent↗

Diverse functions of antioxidants.

All biological organisms have developed a defense system against oxidative stress, which is comprised of many kinds of antioxidants. Antioxidants are classified by function into four categories; preventive antioxidants; radical scavenging antioxidants; repair and de novo antioxidants; and adaptation. Radical scavenging antioxidants have the greatest advantage. Although the activities of radical scavenging antioxidant are determined by several factors, their chemical structure is of key importance. Furthermore, radical scavenging antioxidants have been explored to have a novel function by which they regulate gene expression of cell.

Animals↗

Pro-opiomelanocortin (POMC) deficiency and peripheral melanocortins in obesity.

Melanocortin peptides, derived from pro-opiomelanocortin (POMC), appear to play a significant role in appetite and body weight regulation. Expression of the Pomc gene in the central nervous system results in the production of melanocortin peptides, which bind to the melanocortin-4 receptor (MC4-R) and inhibit food intake. MC4-R knockout mice exhibit adult-onset obesity, whereas MC4-R agonists suppress food intake in several models of obesity. Recently, Pomc knockout mice were generated and shown to develop hyperphagia and obesity with a time-course and severity comparable to MC4-R knockout mice, whereas daily administration of a stable alpha-melanocyte stimulating hormone analogue reversed this effect. These data clearly implicate POMC peptides and melanocortin receptors in the pathophysiology of obesity and provide important new tools for their development as therapeutic targets in obesity.

Animals↗

Extracellular Ba(2+) blocks the cardiac transient outward K(+) current.

Ba(2+) is widely used as a tool in patch-clamp studies because of its ability to block a variety of K(+) channels and to pass Ca(2+) channels. Its potential ability to block the cardiac transient outward K(+) current (I(to)) has not been clearly documented. We performed whole cell patch-clamp studies in canine ventricular and atrial myocytes. Extracellular application of Ba(2+) produced potent inhibition of I(to) with an IC(50) of approximately 40 microM. The effects were voltage independent, and the inactivation kinetics were not altered by Ba(2+). The potency of Ba(2+) was approximately 10 times higher than that of 4-aminopyridine (a selective I(to) blocker with an IC(50) of 430 microM) under identical conditions. By comparison, Ba(2+) blockade of the inward rectifier K(+) current was voltage dependent; the IC(50) was approximately 20 times lower (2.5 microM) than that for I(to) when determined at -100 mV and was comparable to I(to) as determined at -60 mV (IC(50) = 26 microM). Ba(2+) concentrations of </=1 mM or higher failed to block ultrarapid delayed rectifier K(+) current. Our data suggest that Ba(2+) can be considered a potent blocker of I(to).

4-Aminopyridine↗

Regulation of adiposity by dietary calcium.

Recent data from this laboratory demonstrate that increasing adipocyte intracellular Ca(2+) results in a coordinated stimulation of lipogenesis and inhibition of lipolysis. We have also noted that increasing dietary calcium of obese patients for 1 year resulted in a 4.9 kg loss of body fat (P<0.01). Accordingly, we tested the possibility that calcitrophic hormones may act on adipocytes to increase Ca(2+) and lipid metabolism by measuring the effects of 1, 25-(OH)(2)-D in primary cultures of human adipocytes, and found significant, sustained increases in intracellular Ca(2+) and a corresponding marked inhibition of lipolysis (EC(50) approximately 50 pM; P<0.001), suggesting that dietary calcium could reduce adipocyte mass by suppressing 1,25-(OH)(2)-D. To test this hypothesis, we placed transgenic mice expressing the agouti gene specifically in adipocytes on a low (0.4%) Ca/high fat/high sucrose diet either unsupplemented or with 25 or 50% of the protein replaced by non-fat dry milk or supplemented to 1.2% Ca with CaCO(3) for 6 wk. Weight gain and fat pad mass were reduced by 26-39% by the three high calcium diets (P<0.001). The high calcium diets exerted a corresponding 51% inhibition of adipocyte fatty acid synthase expression and activity (P<0.002) and stimulation of lipolysis by 3. 4- to 5.2-fold (P<0.015). This concept of calcium modulation of adiposity was further evaluated epidemiologically in the NHANES III data set. After controlling for energy intake, relative risk of being in the highest quartile of body fat was set to 1.00 for the lowest quartile of Ca intake and was reduced to 0.75, 0.40, and 0.16 for the second, third, and fourth quartiles, respectively, of calcium intake for women (n=380;P<0.0009); a similar inverse relationship was also noted in men (n=7114; P<0.0006). Thus, increasing dietary calcium suppresses adipocyte intracellular Ca(2+) and thereby modulates energy metabolism and attenuates obesity risk.

Adipocytes↗

[The in vivo degradation, adsorption and excretion of poly(epsilon-caprolactone)].

The in vivo degradation of poly(epsilon-caprolactone(PCL) was studied in rats. The results showed that the PCL capsules with an initial molecualr weight of 66,000 stayed intact in vivo for 2 years, although the molecular weight of the capsules gradually declined during the two-year implantation. It then degraded into low molecular wight pieces with the extension of the implantation. Tritium-labeled low molecular weight PCL was subcutaneously implanted in rats to further investigate the absorption and excretion of the material. The radioactivity was first detected in blood 15 days post the implantation. At the same time radioactive excreta were recovered from feces and urine. An accumulative 92% of the implanted radioactive dosage was excreted from feces and urine 135 days post the implantation. In the meanwhile, the blood radioactivity dropped to the background level. Radioactivity in the organs was all close to the background level indicating that the material did not cumulate in body tissue and could be completely excreted.

Absorption↗

[Expression, purification and identification of human IFN-alpha 2 b/HBV Pre S2 fusion protein].

OBJECTIVE: To express a fusion protein of human interferon-a2b and HBV Pre S2 in E.coli for the purpose of investigating anti-HBV immunomodulatory protein. METHODS: Human interferon-a2b and HBV Pre S2 encoding genes were amplified from plasmid templates through PCR, then fused and cloned into plasmid pBV220 through engineering technique to generate expression plasmid pBV-IFN-Pre S2. The plasmid was transfected into E. coli to produce fusion protein. RP-HPLC and ion-exchange chromatography were employed to purify fusion protein. RESULTS: 27 kDa fusion protein was expressed up to 15% of total bacterial protein in E. coli. After purification, the purity of fusion protein reached 95% of total protein. Anti-viral assay showed that IFN-Pre S2 protein induced a VSV-resistant activity of 1.25 x 10(8) lU/mg protein in Wish cell line, similar to the bioactivity of original recombinant human IFN-alpha 2b. ELISA data showed that IFN-Pre S2 protein had antigenicities of both human IFN-alpha 2b and HBV Pre S2. In addition, fusion protein showed the feature of binding to polymeric human serum albumin (PHSA). CONCLUSIONS: The bifunctional fusion protein was efficiently expressed in E. coli. The work provided initial evidence for studying PHSA-receptor-targeting IFN-alpha 2b,which might have potential application for the treatment of HBV infection.

Amino Acid Sequence↗

[Detection of core promoter mutations in chronic hepatitis B].

OBJECTIVE: To study the core promoter mutation in chronic hepatitis B and its effect on viral serology. METHODS: HBV core promoter gene fragments were amplified by using mismatched PCR combined with a restriction fragment length polymorphism assay. The PCR products were digested with Bcl I and subjected to electrophoresis on agarose gels. RESULTS: We investigated the core promoter mutation in 89 patients with HBV DNA positive. The patterns of restriction fragment length polymorphism (RFIP) of the core promoter gene were distinguished and verified by direct sequencing. The combined mutations of nucleotides (nt) 1762 and 1764 in the core promoter from A to T and G to A were detected in 47 individuals, 21 of 43 HBeAg positive patients and 26 of 46 anti- HBe positive cases were found infected with this combined mutant. These two groups showed no significant difference (P > 0.05). The combined mutation was found in 11 of the 15 patients with medium and severe chronic hepatitis. In 5 chronic hepatitis B patients with coexistence of wild-type and mutant a tendency of superior accumulation of mutant was found. CONCLUSIONS: This study suggests that the core promoter mutations commonly exist in Chinese chronic hepatitis B patients. The mutation can only reduce the pre-core mRNA transcribing efficiency, but cannot discontinue the synthesis of HBeAg. The effect on serology in this mutation is different from that in pre-core stop 28 mutation. The superior accumulation of mutations seems relating to the degree of chronic liver disease.

Adolescent↗

[Distribution of HIV resistance CCR5-delta 32, CCR2-64 I and SDF1-3'A alleles and their polymorphisms in the Han population in China].

OBJECTIVE: To study the frequency and polymorphism of three mutations (CCR5(Delta)32, CCR2-64I and SDF1-3'A alleles) conferring resistance to determined HIV-1/AIDS in the indigenous Han population in China. METHODS: The study population included 1,267 subjects, of which consisted 98.7% (1,251/1,267) Han people. The genotypes of the three mutations were respectively, detected by polymerase chain reaction (PCR) for CCR5(Delta)32 mutation, or by PCR/RFLP (restriction fragment length polymorphism) assay with the digestion of restriction endonuclease Bsa BI and Msp I for CCR2-64I and SDF1-3'A mutations. DNA sequencing was employed to confirm the accuracy of PCR or PCR/RFLP products. RESULTS: The frequency of the mutant alleles were: 0.00119 for CCR5(Delta)32; 0.20023 for CCR2-64I, and 0.28723 for SDF1-3'A. The three heterozygous CCR5-wt/Delta32 mutants were identified and no homozygotes were detected in indigenous Han population. The frequencies of CCR2-64I and SDF1-3'A alleles in China were higher than those of Caucasians descents in the USA and Europe. CONCLUSION: Our data was the first findings on the frequency and polymorphism of CCR5(Delta)32, CCR2-64I and SDF1-3'A alleles in indigenous Han population in China which implied that the indigenous Han people might have a higher genetic susceptibility to the infection of sexually transmitted HIV-1 (R-5) strain. Further study is needed to clarify the significance of higher frequency of CCR2-64I and SDF1-3'A alleles in Han population.

Alleles↗

[Polymorphisms of chemokine receptor alleles influencing genetic susceptibility to HIV-1 infection in Mongolia population in China].

OBJECTIVE: Mutant frequency and polymorphism of HIV-1 resistance CCR5-Delta32, CCR2b-64I and SDF1-3'A alleles were investigated in Chinese population from Mongolian ethnic origin. METHODS: Whole blood samples from 134 Mongolian subjects were collected randomly and their genomic DNA were extracted using Qiagen Blood Kit. Allelic frequency was identified by means of PCR or PCR-RFLP analysis. Allelic polymorphism in population and between sex in the sample as well as correlation of the three genes were analyzed by chi(2) test. RESULTS: The frequencies of the three alleles were as following: CCR5-Delta32 1.1%, CCR2b-64I 24.8% and SDF1-3'A 22.0% respectively. Distribution of the three mutant alleles among the Mongolian population was in accordance with Hardy-Weinberg equilibrium. Statistical analysis showed there was a higher frequency of CCR2b-64I in female than in male subjects (29.2% vs 19.7%). No Statistical difference was found in the allelic frequencies of both CCR5-Delta32 and SDF1-3'A between male and female individuals. CONCLUSION: Compared with the Caucasian American, there were higher frequencies of CCR2b-64I and SDF1-3'A alleles and lower frequency of CCR5-Delta32 allele found in Mongolian population while the factors responsible for the variation of genetic polymorphisms in different ethnic populations need to be clarified.

Adolescent↗

[Matrix metalloproteinase-1 and coronary atheroslerotic plaque rupture].

OBJECTIVE: To investigate the relationship between matrix metalloproteinase-1 (MMP-1) and coronary atherosclerotic plaque rupture, and the cellular source of MMP-1 within the plaques. METHODS: 42 cases, among which 20 died of acute myocardial infarction, 10 with unstable angina history and 12 with stable angina history but died of other diseases, were selected. All the branch of coronary arteries were examined, parts of the segments were selected for immunohistochemical staining, 5 markers against alpha-smooth muscle actin, CD20, CD45RO, CD68 and MMP-1 were performed. RESULTS: Plaque rupture and thrombosis were found in almost all the cases of acute myocardial infarction and unstable angina. But in the cases of stable angina, the majority of the plaques were stable ones. The expression of MMP-1 in the ruptured plaques were stronger than the unruptured ones (t = -8.07, P < 0.05); Positive relationship was also noted between the expression of CD68 and MMP-1 (r = 0.75, P < 0.05). CONCLUSION: Macrophages are capable of degrading extracellular matrix by secreting MMP-1; Enhanced secretion of MMP-1 within the coronary atherosclerotic plaques has significant relationship with plaque rupture.

Angina, Unstable↗

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

5' Untranslated Regions↗

1-Methyl-4-phenyl-2,3-dihydropyridinium is transformed by ubiquinone to the selective nigrostriatal toxin 1-methyl-4-phenylpyridinium.

We have studied the interaction of coenzyme Q with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and its metabolites, 1-methyl-4-phenyl-2,3-dihydropyridinium (MPDP(+)) and 1-methyl-4-phenylpyridinium (MPP(+)), the real neurotoxin to cause Parkinson's disease. Incubation of MPTP or MPDP(+) with rat brain synaptosomes induced complete reduction of endogenous ubiquinone-9 and ubiquinone-10 to corresponding ubiquinols. The reduction occurred in a time- and MPTP/MPDP(+) concentration-dependent manner. The reduction of ubiquinone induced by MPDP(+) went much faster than that by MPTP. MPTP did not reduce liposome-trapped ubiquinone-10, but MPDP(+) did. The real toxin MPP(+) did not reduce ubiquinone in either of the systems. The reduction by MPTP but not MPDP(+) was completely prevented by pargyline, a type B monoamine oxidase (MAO-B) inhibitor, in the synaptosomes. The results indicate that involvement of MAO-B is critical for the reduction of ubiquinone by MPTP but that MPDP(+) is a reductant of ubiquinone per se. It is suggested that ubiquinone could be an electron acceptor from MPDP(+) and promote the conversion from MPDP(+) to MPP(+) in vivo, thus accelerating the neurotoxicity of MPTP.

1-Methyl-4-phenylpyridinium↗

RNA aptamers as effective protein antagonists in a multicellular organism.

RNA aptamers selected against proteins can be used to modulate specific protein function. Expression of such reagents in cells and whole organisms could provide a means of dissecting and controlling molecular mechanisms in vivo. We demonstrate that Drosophila B52 protein can be specifically inhibited in vitro and in vivo by a multivalent RNA aptamer. This inhibitory aptamer RNA binds B52 avidly and inhibits B52-stimulated pre-mRNA splicing. It can be expressed in cultured cells and whole animals in a stable form that accumulates up to 10% of total mRNA. It binds B52 in vivo and suppresses all phenotypes caused by B52 overexpression. The strategies presented here should prove general in design and expression of functional and therapeutic RNAs.

Animals↗

Choline modulates cardiac membrane repolarization by activating an M3 muscarinic receptor and its coupled K+ channel.

Choline is a necessary substrate of the lipid membrane and for acetylcholine synthesis. Accumulating evidence indicates that besides being a structural component, choline is also a functional modulator of the membrane. It has been shown to be a muscarinic acetylcholine receptor (mAChR) agonist and can induce a novel K+ current in cardiac cells. However, the potential role of choline in modulating cardiac functions remained unstudied despite that mAChRs are known to be important in regulating heart functions. With microelectrode techniques, we found that choline produced concentration-dependent (0.1 approximately 10 mm) decreases in sinus rhythm and action potential duration in isolated guinea pig atria. The effects were reversed by 2 nm 4DAMP (an M3-selective antagonist). Whole-cell patch-clamp recordings in dispersed myocytes from guinea pig and canine atria revealed that choline is able to induce a K+ current with delayed rectifying properties. The choline-induced current was suppressed by low concentrations of 4DAMP (2 approximately 10 nm). Antagonists toward other subtypes (M1, M2 or M4) all failed to alter the current. The affinity of choline (Kd) at mAChRs derived from displacement binding of [3H]-NMS in the homogenates from dog atria was 0.9 mm, consistent with the concentration needed for the current induction and for the HR and APD modulation. Our data indicate that choline modulates the cellular electrical properties of the hearts, likely by activating a K+ current via stimulation of M3 receptors.

Animals↗

Formation of phospholipid hydroperoxides and its inhibition by alpha-tocopherol in rat brain synaptosomes induced by peroxynitrite.

Peroxynitrite resulted from the reaction of nitric oxide and superoxide anion has been implicated in the genesis of neurotoxicity. In this study, the oxidation of phospholipids in rat brain synaptosomes induced by peroxynitrite generated from 3-morpholinosydnonimine (SIN-1) was studied in vitro. The formation and accumulation of phospholipid hydroperoxides, including phosphatidylcholine hydroperoxide (PCOOH) and phosphatidyl-ethanolamine hydroperoxide (PEOOH) in rat brain synaptosomes induced by peroxynitrite, were observed. PEOOH and PCOOH were formed rapidly and SIN-1 concentration-dependently. The hydroperoxides formed in synaptosomes were unstable and it was suggested that phospholipase A2 played a role in degradation of the hydroperoxides. The endogenous alpha-tocopherol acted as a potent antioxidant. It was oxidized very rapidly and concentration-dependently by SIN-1 to alpha-tocopheryl quinone. Furthermore, uric acid was found to be an effective antioxidant in inhibiting oxidative damage to synaptosomal lipids induced by SIN-1. The results provide direct evidence to show that peroxynitrite can not only deplete alpha-tocopherol, but also cause production of phospholipid hydroperoxides resulting in disrupted brain tissue.

Acetophenones↗

Template-imprinted nanostructured surfaces for protein recognition.

Synthetic materials capable of selectively recognizing proteins are important in separations, biosensors and the development of biomedical materials. The technique of molecular imprinting creates specific recognition sites in polymers by using template molecules. Molecular recognition is attributed to binding sites that complement molecules in size, shape and chemical functionality. But attempts to imprint proteins have met with only limited success. Here we report a method for imprinting surfaces with protein-recognition sites. We use radio-frequency glow-discharge plasma deposition to form polymeric thin films around proteins coated with disaccharide molecules. The disaccharides become covalently attached to the polymer film, creating polysaccharide-like cavities that exhibit highly selective recognition for a variety of template proteins, including albumin, immunoglobulin G, lysozyme, ribonuclease and streptavidin. Direct imaging of template recognition is achieved by patterning a surface at the micrometre scale with imprinted regions.

Adsorption↗