PubMed Health⌕ Search

Biomedical subjects

H Tsuruga

Publications and source records attributed to H Tsuruga.

17 recordsLinked to original sources

Increased expression of humanin peptide in diffuse-type pigmented villonodular synovitis: implication of its mitochondrial abnormality.

OBJECTIVES: To define the pathogenesis of pigmented villonodular synovitis (PVNS), by searching for highly expressed genes in primary synovial cells from patients with PVNS. METHODS: A combination of subtraction cloning and Southern colony hybridisation was used to detect highly expressed genes in PVNS in comparison with rheumatoid synovial cells. Northern hybridisation was performed to confirm the differential expression of the humanin gene in PVNS. Expression of the humanin peptide was analysed by western blotting and immunohistochemistry. Electron microscopic immunohistochemistry was performed to investigate the distribution of this peptide within the cell. RESULTS: 68 highly expressed genes were identified in PVNS. Humanin genes were strongly expressed in diffuse-type PVNS, but were barely detected in nodular-type PVNS, rheumatoid arthritis, or osteoarthritis. Humanin peptide was identified in synovium from diffuse-type PVNS, and most of the positive cells were distributed in the deep layer of the synovial tissue. Double staining with anti-humanin and anti-heat shock protein 60 showed that humanin was expressed mainly in mitochondria. Electron microscopy disclosed immunolocalisation of this peptide, predominantly around dense iron deposits within the siderosome. CONCLUSIONS: Increased expression of the humanin peptide in mitochondria and siderosomes is characteristic of synovial cells from diffuse-type PVNS. Humanin is an anti-apoptotic peptide which is encoded in the mitochondrial genome. Present findings suggest that mitochondrial dysfunction may be the principal factor in pathogenesis of diffuse-type PVNS and that humanin peptide may play a part in the neoplastic process in this form of PVNS.

Arthritis, Rheumatoid↗

STAT5 induces macrophage differentiation of M1 leukemia cells through activation of IL-6 production mediated by NF-kappaB p65.

We recently demonstrated that STAT5 can induce a variety of biological functions in mouse IL-3-dependent Ba/F3 cells; STAT5-induced expression of pim-1, p21(WAF/Cip1), and suppressor of cytokine signaling-1/STAT-induced STAT inhibitor-1/Janus kinase binding protein is responsible for induction of proliferation, differentiation, and apoptosis, respectively. In the present study, using a constitutively active STAT5A (STAT5A1*6), we show that STAT5 induces macrophage differentiation of mouse leukemic M1 cells through a distinct mechanism, autocrine production of IL-6. The supernatant of STAT5A1*6-transduced cells contained sufficient concentrations of IL-6 to induce macrophage differentiation of parental M1 cells, and STAT3 was phosphorylated on their tyrosine residues in these cells. Treatment of the cells with anti-IL-6 blocking Abs profoundly inhibited the differentiation. We also found that the STAT5A1*6 transactivated the IL-6 promoter, which was mediated by the enhanced binding of NF-kappaB p65 (RelA) to the promoter region of IL-6. These findings indicate that STAT5A cooperates with Rel/NF-kappaB to induce production of IL-6, thereby inducing macrophage differentiation of M1 cells in an autocrine manner. In summary, we have shown a novel mechanism by which STAT5 induces its pleiotropic functions. Cytokines

Animals↗

Characterization of semen collected from beagles and captive Japanese black bears (Ursus thibetanus japonicus).

This study characterized semen collected from the Japanese black bear, Ursus thibetanus aponicus, to provide information on semen cryopreservation for artificial breeding. Preliminary studies using a beagle dog as the model species showed that sperm concentration and total sperm count were lower in semen collected by electroejaculation than in semen collected by digital manipulation, but that sperm motility, viability and morphology were similar. Characterization of semen obtained from Japanese black bears by electroejaculation under general anesthesia revealed that semen volume and total number of spermatozoa collected were lower; but that sperm concentration, motility, viability and morphology were equivalent to those reported in other ursids. When semen was collected via a catheter inserted into the urethra during the stimulation for ejaculation, the sperm concentration, total sperm count and motility were relatively higher than when semen was collected directly in a test tube. Specific normal semen characteristics (mean +/- SEM) were pH, 7.6 +/- 0.0; volume, 0.212 +/- 0.038 mL; sperm concentration, 361 +/- 100 x 10(6)/mL; total sperm count, 84.0 +/- 32.2 x 106; +++ motility, 30 +/- 5%; motility, 77 +/- 3%; viability 77 +/- 2%; and abnormal morphology, 11+/- 2%. These results suggest that semen can be collected from Japanese black bears by electroejaculation.

Animals↗

Identification of novel membrane and secreted proteins upregulated during adipocyte differentiation.

Adipose tissue is the largest organ in the body that secretes soluble proteins such as cytokines. A preadipocyte cell line 3T3-L1 has been widely used for investigations of mechanisms of adipocyte differentiation. 3T3-L1 cells convert to adipocytes in the presence of 1-methyl-3-isobutylxanthine, dexamethasone, and insulin. We screened a cDNA library derived from differentiated 3T3-L1 cells, using the SST-REX method (signal sequence trap by retrovirus-mediated expression screening method). Screening of 4 x 10(5) clones gave rise to 63 known and 8 novel clones. The known clones represented 28 independent proteins, 21 of which were secreted proteins and 7 were membrane proteins. The novel clones represented 7 independent proteins, 5 of which had no similarity to known proteins. Interestingly, most of these novel genes showed differentiation- and tissue-specific expression. The present results indicate that adipocytes specific genes or adipocyte differentiation-related genes encoding membrane and secreted proteins can be readily identified if signal sequence trap screening of differentiated adipocyte-derived cDNAs is done.

3T3 Cells↗

Cell growth-regulated expression of mammalian MCM5 and MCM6 genes mediated by the transcription factor E2F.

Initiation of DNA replication requires the function of MCM gene products, which participate in ensuring that DNA replication occurs only once in the cell cycle. Expression of all mammalian genes of the MCM family is induced by growth stimulation, unlike yeast, and the mRNA levels peak at G1/S boundary. In this study, we examined the transcriptional activities of isolated human MCM gene promoters. Human MCM5 and MCM6 promoters with mutation in the E2F sites failed in promoter regulation following serum stimulation and exogenous E2F expression. In addition, we identified a novel E2F-like sequence in human MCM6 promoter which cooperates with the authentic E2F sites in E2F-dependent regulation. Forced expression of E2F1 could induce expression of all members of the endogenous MCM genes in rat embryonal fibroblast REF52 cells. Our results demonstrated that the growth-regulated expression of mammalian MCM5 and MCM6 genes, and presumably other MCM members, is primarily regulated by E2F through binding to multiple E2F sites in the promoters.

Animals↗

Immobilization of sika deer with medetomidine and ketamine, and antagonism by atipamezole.

Forty wild sika deer (Cervus nippon) were immobilized with medetomidine and ketamine and reversed by atipamezole in summer and fall captures from September 1994 to October 1995. For large yearling and older deer, mean +/- SD doses of 57.0+/-15.6 microg/kg medetomidine and 1.64+/-0.49 mg/kg (male) or 4.02+/-1.16 mg/kg (female) of ketamine were administered by intramuscular injection. For calves and small yearlings, 69.3+/-7.0 microg/kg medetomidine and 2.69+/-0.44 mg/kg ketamine were administered. While immobilized, deer were easy to handle, and muscles were well relaxed. After intramuscular administration of atipamezole (about 5 times the dose of medetomidine), deer recovered rapidly and smoothly.

Adrenergic alpha-Agonists↗

Electroejaculation and semen characteristics of the captive Hokkaido brown bear (Ursus arctos yesoensis).

An electroejaculation technique was applied to the Hokkaido brown bear (Ursus arctos yesoensis) for semen collection and characterization of their seminal traits. Ten captive sexually mature bears were anesthetized and subjected to 21 electroejaculation trials during their mating season in 1995 and 1996. Spermic electroejaculates were recovered from 6 of the 10 bears (14 of 21 trials). The semen was characterized by serous fluid of semitransparent white color and a neutral pH. The mean values of ejaculate volume, sperm concentration, percentage of sperm motility, percentage of live spermatozoa, and percentage of pleiomorphic forms were 2.7 ml, 471.6 x 10(6) cells/ml, 80.2%, 89.7% and 21.8%, respectively. Although there was considerable variation among the seminal traits of the individual bears, the electroejaculation technique was effective in obtaining ejaculates from captive bears.

Animals↗

Structure, expression, and chromosomal localization of human GAK.

We previously cloned a rat cDNA encoding GAK, an association partner of cyclin G and CDK5. Here, we report the cloning of a cDNA encoding human GAK (1311 amino acids) and show that all of the unique motifs that characterize rat GAK, such as the presence of a Ser/Thr kinase domain, a tensin/auxilin homologous domain, and a Tyr phosphorylation target site, are conserved. The expression profiles of GAK and cyclin G during the synchronized HeLa cell cycle showed that GAK expression oscillates slightly, peaking at G1 phase, although the histone H1 kinase activity remains constant throughout the cell cycle. We also found that the kinase activity of immunoprecipitates of anti-cyclin G antibody fluctuates during the cell cycle with a peak at G1 phase, although the expression level of cyclin G remains almost constant. Northern blot analysis showed that GAK is expressed ubiquitously, with the highest level of expression being observed in the testis. By the FISH technique, we assigned the chromosomal localization of GAK to 4p16.

Amino Acid Sequence↗

Expression, nuclear localization and interactions of human MCM/P1 proteins.

We report here the comparative analysis of human Mcm/P1 proteins (HsMcm2, -3, -5 and -7), including a characterization of their mutual interactions, cell cycle dependent expression and nuclear localization during the cell cycle and the quiescent state. The mRNA levels of these genes, which undergo cell cycle dependent oscillations with a peak at G1/S phase, may be regulated by E2F motifs, two of which were detected in the 5' upstream region of the HsMCM5 gene. In contrast, the protein levels of these Mcm proteins were found to remain rather constant during the HeLa cell cycle. However, their levels gradually increased in a variable manner as KD cells progressed from GO into the G1/S phase. In the GO stage, the amounts of HsMcm2 and -5 proteins were much lower than those of HsMcm7 and -3 proteins, suggesting that they are not present in stoichiometric amounts, and that only a proportion of these molecules actively participate in cell cycle regulation as part of Mcm/P1 complexes.

Amino Acid Sequence↗

HsMCM6: a new member of the human MCM/P1 family encodes a protein homologous to fission yeast Mis5.

BACKGROUND: The tight regulatory mechanism that prevents more than one round of chromosomal DNA replication per cell cycle is thought to require the function of Mcm/P1 proteins. We report here the structural and functional analyses of HsMcm6, a human homologue of the Mis5 of Schizosaccharomyces pombe. RESULTS: We demonstrate here that the transcription of the HsMCM6 gene was repressed in quiescent cells but was rapidly induced at the G1/S phase by growth factor stimulation. The 5' regulatory region of the HsMCM6 gene was found to harbour four putative E2F binding motifs, and these were responsible for the promoter activity. The HsMcm6 protein level oscillated during the cell cycle, with a peak at the G1/S phase. We also showed that the cell-cycle dependent change of subcellular localization of HsMcm6 resembles those of other Mcm/P1 proteins. HsMcm6 consists of two forms, a form extractable by Nonidet P-40 and the nucleus-bound form. A demonstration of the association of HsMcm6 with HsMcm2 and HsMcm7 in vivo supports the idea that they behave as a heteromeric complex. We mapped the HsMCM6 gene at 2q12-14. CONCLUSION: The results indicate that the behaviour of HsMcm6 is reminiscent of replication licensing factor like other Mcm/P1 family members.

Amino Acid Sequence↗

Structure and chromosomal assignment of the human cyclin G gene.

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Amino Acid Sequence↗

Seasonal variations of blood haptoglobin level of brown bears in Japan.

Haptoglobin (Hp), a hemoglobin-binding protein, is known as an acute phase protein increasing in blood during inflammation in most mammals. On the basis of our previous studies on purification and characterization of bear Hp (Comp. Biochem. Physiol. 110B, 785-789, 1995), in this study, we developed an immunoassay method to measure serum Hp level in bear, and measured the concentration of Hp in blood samples collected from 84 reared and 25 wild brown bears in Hokkaido, Japan. The mean serum Hp concentration was 0.94 +/- 0.25 mg/ml in wild bears, which is nearly equal to those reported in other species. In reared bears, the Hp concentration was apparently higher (3.82 +/- 0.29 mg/ml), although total protein and albumin concentrations were nearly equal in the two groups. A significant seasonal variation of serum Hp, low in spring and high in autumn and winter, was found in reared bears. Possible factors participating in the seasonal variation were discussed with special references to hibernation.

Animals↗

DNA polymerase beta gene mutation in human prostate cancer.

DNA polymerase beta is a nuclear protein essential to DNA repair in mammalian cells. A high frequency of mutations in this gene has been reported in colorectal cancers. To clarify the tumorigenesis steps of human prostate cancers in the molecular basis, we examined the entire coding region of the human DNA polymerase beta gene in human prostate cancer tissues using polymerase chain reaction, single-strand conformational polymorphism analysis of RNA, and sequencing analysis. Consequently, we detected DNA polymerase beta gene mutations in 2 of 12 cases (17%). The first case is an A to G transition at nucleotide 893, resulting in a substitution of the amino acid from tyrosine to cysteine. In the second case, we found an A to G transition at nucleotide 305, a T deletion at nucleotide 569, and an A insertion into the 6 repeats of A from nucleotide 612 to 617. This T deletion shifted the subsequent reading frame and resulted in the premature termination at codon 163 instead of 336. The two cases were advanced grade and stage. Present results suggest that polymerase beta gene mutations, although they occurred at relatively low frequency, are involved in certain cases of human prostate carcinogenesis.

Adenocarcinoma↗

Application of DNA fingerprinting in the Hokkaido brown bear (Ursus arctos yesoensis).

DNA fingerprinting employing a minisatellite Myo probe was used for individual identification and paternity determination in Hokkaido brown bears (Ursus arctos yesoensis). We used two restriction enzymes, HinfI and HaeIII to make DNA fingerprints. Band patterns obtained from randomly selected bears were compared with each other, and the probability x that fragment in an individual was also present in the other was 0.69 for HinfI and 0.83 for HaeIII. The value for HinfI (0.69) was similar to that obtained from other species, such as dog and domestic animals, and the mean probability of all fragments was calculated to be 2.5 x 10(-2). The results suggest that DNA fingerprinting applying the combination of HinfI and Myo is available for individual identification. On the other hand, the ability to determine paternity seemed to be insufficient owing to the lack of paternal fragments, although the band patterns reflected the correct relationships between child and father.

Animals↗

Estimate of genetic variations in Hokkaido brown bears (Ursus arctos yesoensis) by DNA fingerprinting.

Genetic variations within and between local populations of Hokkaido brown bears, Ursus arctos yesoensis, were quantified by means of DNA fingerprinting using a minisatellite DNA probe. The estimates of the average heterozygosity (gene diversity) H were 0.302 and 0.241 for the populations on the southwestern part of the Oshima peninsula and the Shiretoko peninsula, respectively. These values suggest that local populations studied in this study have low genetic variability compared with those for other animals. The degree of genetic differentiation between the populations, measured by the coefficient of gene diversity (GST), was 7.9 percent and 19.5 percent. These results indicate a low degree of genetic differentiation between the local populations. The results obtained are discussed in relation to a population bottleneck in the ancestors and subsequent expansion of their habitat.

Animals↗