Biomedical subjects

Hannah J Zhang

Publications and source records attributed to Hannah J Zhang.

13 recordsLinked to original sources

PubMed2006

An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations.

Aging is an inherently complex process that is manifested within an organism at genetic, molecular, cellular, organ, and system levels. Although the fundamental mechanisms are still poorly understood, a growing body of evidence points toward reactive oxygen species (ROS) as one of the primary determinants of aging. The "oxidative stress theory" holds that a progressive and irreversible accumulation of oxidative damage caused by ROS impacts on critical aspects of the aging process and contributes to impaired physiological function, increased incidence of disease, and a reduction in life span. While compelling correlative data have been generated to support the oxidative stress theory, a direct cause-and-effect relationship between the accumulation of oxidatively mediated damage and aging has not been strongly established. The goal of this minireview is to broadly describe mechanisms of in vivo ROS generation, examine the potential impact of ROS and oxidative damage on cellular function, and evaluate how these responses change with aging in physiologically relevant situations. In addition, the mounting genetic evidence that links oxidative stress to aging is discussed, as well as the potential challenges and benefits associated with the development of anti-aging interventions and therapies.

Aging↗

PubMed2006

NAD(P)H oxidase-induced oxidative stress in sympathetic ganglia of apolipoprotein E deficient mice.

Superoxide anion (O2*-) is increased throughout the arterial wall in atherosclerosis. The oxidative stress contributes to lesion formation and vascular dysfunction. In the present study, we tested the hypothesis that NAD(P)H oxidase-derived O2*- is increased in nodose sensory ganglia and sympathetic ganglia of apolipoprotein E deficient (apoE-/-) mice, an established animal model of atherosclerosis. O2*- measured ex vivo by L-012-enhanced chemiluminescence was increased by 79+/-17% in whole sympathetic ganglia from apoE-/- mice (n=5) compared with sympathetic ganglia from control mice (n=5) (P<0.05). In contrast, O2*- was not elevated in nodose ganglia from apoE-/- mice. Dihydroethidium staining confirmed the selective increase in O2*- in sympathetic ganglia of apoE-/- mice, and revealed the contribution of both neurons and non-neuronal cells to the O2*- generation. We investigated the enzymatic source of increased O2*- in sympathetic ganglia of apoE-/- mice. The mRNA expression of gp91phox, p22phox, p67phox, and p47phox subunits of NAD(P)H oxidase measured by real time RT-PCR was increased approximately 3-4 fold in sympathetic ganglia of apoE-/- mice (n=5) compared with control ganglia (n=5). NADPH oxidase activity measured by lucigenin chemiluminescence was increased by 68+/-12% in homogenates of sympathetic ganglia from apoE-/- mice (n=7) compared with control ganglia (n=7) (P<0.05). The results identify sympathetic ganglia as a novel site of oxidative stress in atherosclerosis, and suggest that upregulation of NAD(P)H oxidase is the source of increased O2*- generation. We speculate that oxidative stress in sympathetic ganglia may contribute to impaired baroreflex control of sympathetic nerve activity.

Analysis of Variance↗

PubMed2005

Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor.

Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that governs cellular responses to reduced O2 availability by mediating crucial homeostatic processes. HIF-1 is composed of an HIF-1alpha subunit and an HIF-1beta subunit. HIF-1alpha is degraded following enzyme-dependent hydroxylation of prolines of HIF-1alpha in the presence of molecular oxygen, Fe2+, alpha-ketoglutarate, and ascorbate. These cofactors contribute to the redox environment of cells. The antioxidant enzyme manganese superoxide dismutase (MnSOD) also modulates the cellular redox environment. Here we show that MnSOD suppressed hypoxic accumulation of HIF-1alpha protein in human breast carcinoma MCF-7 cells. This suppression was biphasic depending on MnSOD activity. At low levels of MnSOD activity, HIF-1alpha protein accumulated under hypoxic conditions. At moderate levels of MnSOD activity (two- to six-fold increase compared to parent cells), these accumulations were blocked. However, at higher levels of MnSOD activity (>6-fold increase), accumulation of HIF-1alpha protein was again observed. This biphasic modulation was observed under both 1 and 4% O2. Coexpression of mitochondrial hydrogen peroxide-removing proteins prevented the accumulation of HIF-1alpha protein in cells with high levels of MnSOD; this effect demonstrates that the restabilization of HIF-1alpha observed in high MnSOD overexpressors is probably due to hydrogen peroxide, most likely produced from MnSOD. Hypoxic induction of vascular endothelial growth factor (VEGF) protein was also suppressed by elevated MnSOD activity and its levels reflected HIF-1alpha protein levels. These observations demonstrated that HIF-1alpha accumulation and VEGF expression could be modulated by the antioxidant enzyme MnSOD.

Adenocarcinoma↗

PubMed2005

Chronic antioxidant enzyme mimetic treatment differentially modulates hyperthermia-induced liver HSP70 expression with aging.

One postulated mechanism for the reduction in stress tolerance with aging is a decline in the regulation of stress-responsive genes, such as inducible heat shock protein 72 (HSP70). Increased levels of oxidative stress are also associated with aging, but it is unclear what impact a prooxidant environment might have on HSP70 gene expression. This study utilized a superoxide dismutase/catalase mimetic (Eukarion-189) to evaluate the impact of a change in redox environment on age-related HSP70 responses to a physiologically relevant heat challenge. Results demonstrate that liver HSP70 mRNA and protein levels are reduced in old compared with young rats at selected time points over a 48-h recovery period following a heat-stress protocol. While chronic systemic administration of Eukarion-189 suppressed hyperthermia-induced liver HSP70 mRNA expression in both age groups, HSP70 protein accumulation was blunted in old rats but not in their young counterparts. These data suggest that a decline in HSP70 mRNA levels may be responsible for the reduction in HSP70 protein observed in old animals after heat stress. Furthermore, improvements in redox status were associated with reduced HSP70 mRNA levels in both young and old rats, but differential effects were manifested on protein expression, suggesting that HSP70 induction is differentially regulated with aging. These findings highlight the integrated mechanisms of stress protein regulation in eukaryotic organisms responding to environmental stress, which likely involve interactions between a wide range of cellular signals.

Aging↗

PubMed2005

Manganese superoxide dismutase overexpression inhibits the growth of androgen-independent prostate cancer cells.

This study investigates the role of the antioxidant enzyme manganese superoxide dismutase (MnSOD) in androgen-independent human prostate cancer (PC-3) cells' growth rate in vitro and in vivo. MnSOD levels were found to be lower in parental PC-3 cells compared to nonmalignant, immortalized human prostate epithelial cells (P69SV40T). To unravel the role of MnSOD in the prostate cancer phenotype, PC-3 cells were stably transfected with MnSOD cDNA plasmid. The MnSOD protein and activity levels in clones overexpressing MnSOD were increased seven- to eightfold. These cell lines showed elongated cell doubling time, reduced anchorage-independent growth in soft agar compared to parental PC-3 (Wt) cells, and reduced growth rate of PC-3 tumor xenografts in athymic nude mice. Flow cytometric studies showed an increase in membrane potential in the MnSOD-overexpressing clone (Mn32) compared to Wt and Neo cells. Also, production of extracellular H(2)O(2) was increased in the MnSOD-overexpressing clones. As determined by DNA cell cycle analysis, the proportion of cells in G(1) phase was enhanced by MnSOD overexpression. Therefore, MnSOD not only regulates cell survival but also affects PC-3 cell proliferation by retarding G(1) to S transition. Our results are consistent with MnSOD being a tumor suppressor gene in human prostate cancer.

Androgens↗

PubMed2004

Redox modulation of the liver with chronic antioxidant enzyme mimetic treatment prevents age-related oxidative damage associated with environmental stress.

A reduction in stress tolerance is a hallmark of the aging process, and the lowered functional capacity observed in aged organisms is associated with an increased rate of oxidative stress and a greater susceptibility of aged tissues to oxidative injury. In this report, we show that chronic systemic administration of a superoxide dismutase (SOD)/catalase mimetic (EUK-189), delivered over a 1 month period via osmotic pump, prevents heat stress-induced liver injury by dramatically decreasing oxidative damage in aged animals. Widespread liver injury was present in old but not young vehicle-treated rats in response to a 2 day heating protocol. However, SOD/catalase mimetic treatment markedly decreased the hyperthermia-induced liver injury associated in old animals. The reversal of damage with EUK-189 was associated with an improvement in intracellular redox status and a striking reduction in hepatocellular lipid peroxidation. EUK-189 treatment also blocked the activation of activator protein-1 (AP-1), which is a redox-sensitive early response transcription factor involved in the regulation of cellular stress responses. These results demonstrate that oxidative stress plays a unique role in age-related hyperthermic injury and suggest that therapeutic strategies aimed at improving redox potential, such as chronic SOD/catalase mimetic treatment, can prevent the oxidative-mediated damage associated with environmental stress.

Aging↗

PubMed2003

Heat-induced liver injury in old rats is associated with exaggerated oxidative stress and altered transcription factor activation.

A decline in stress tolerance is a hallmark of aging. For instance, older organisms showed extensive hepatic damage, along with increased morbidity and mortality, after environmental heating. We hypothesized that hyperthermic challenge would produce exaggerated oxidative stress in old animals, leading to increased hepatic injury. After a heat-stress protocol, time-course changes in reactive oxygen species (ROS) levels, oxidative damage markers, glutathione (GSH)/glutathione disulfide (GSSG) ratios, and activation of stress-response transcription factors (AP-1 and NF-kappaB) were measured in young and old rats. A small, transient increase in hepatic oxidative damage, with minimal injury, was observed in young rats. However, old rats showed widespread hepatic injury that was manifested over a 24 h period after heating. This pathology was preceded by elevated steady-state levels of ROS, along with large increases in lipid peroxidation products, prolonged hepatic DNA oxidation damage, aberrant GSH/GSSG profiles, and altered activation patterns for AP-1. These data indicate that young animals have an effective oxidation-reduction buffering system in the liver that provides protection from oxidative damage to intracellular macromolecules under stress conditions. In sharp contrast, an environmental challenge in older animals produces exaggerated oxidative stress and alterations in signal transduction pathways, which can contribute to cellular dysfunction and age-related reductions in stress tolerance.

Aging↗

PubMed2003

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Base Sequence↗

PubMed2003

MnSOD up-regulates maspin tumor suppressor gene expression in human breast and prostate cancer cells.

Manganese superoxide dismutase (MnSOD) is an antioxidant enzyme with tumor suppressor activity; however, the molecular mechanisms of MnSOD antitumor effects remain unclear. We hypothesized that MnSOD activity in cancer cells might cause downstream changes in the expression of other tumor suppressor genes. To determine whether maspin, a tumor suppressor gene that inhibits breast cancer cell invasion and metastasis, might be a target of MnSOD, we forced MnSOD expression in several human breast and prostate cancer cell lines by adenovirus-mediated gene transfer and measured maspin mRNA expression. Forced expression of MnSOD caused maspin mRNA to accumulate in a dose-dependent manner in both human breast and prostate cancer cells. Normal p53 was not necessary to mediate the effect of MnSOD because MnSOD up-regulated maspin in cells that harbor wild-type p53 and in cells that harbor mutant p53. Moreover, the effects of MnSOD on maspin were not due to demethylation of the maspin promoter. Analyses of maspin promoter activity, transcriptional run-on, and mRNA stability showed that maspin mRNA stability was the major mechanism for maspin up-regulation by MnSOD. Our findings identify a mechanism underlying MnSOD antitumor effects and provide evidence to support MnSOD as a genetic therapy in the treatment of human breast and prostate cancers.

Adenoviridae↗

PubMed2002

Activation of matrix metalloproteinase-2 by overexpression of manganese superoxide dismutase in human breast cancer MCF-7 cells involves reactive oxygen species.

Matrix metalloproteinases (MMPs) participate in cell migration and remodeling processes by affecting the extracellular matrix. MMP-2 is thought to be involved in cancer cell invasiveness. It has been proposed that the activity of MMP-2 can be modulated by intracellular reactive oxygen species (ROS)/reactive nitrogen species. We hypothesized that manganese superoxide dismutase (MnSOD) could mediate MMP-2 activity by changing the intracellular ROS level and that nitric oxide ((.)NO) may be involved in this process. Human breast cancer MCF-7 cells were stably transfected with plasmids containing MnSOD cDNA. A 2-30-fold increase of MnSOD protein and activity was observed in four clones. Our data demonstrated that overexpression of MnSOD stimulated the activation of MMP-2 with a corresponding elevation of ROS. A decrease in ROS by ebselen, a glutathione peroxidase mimetic, or by transduction of adenovirus containing human catalase or glutathione peroxidase cDNA abolished the effect of MnSOD on MMP-2 activation. Treatment of MCF-7 cells with antimycin A or rotenone increased intracellular ROS production and MMP-2 activation simultaneously. Our data also showed a suppression of endothelial nitric-oxide synthase expression that was accompanied by decreased (.)NO production in MnSOD-overexpressing cells. However, the changes in endothelial nitric-oxide synthase and (.)NO did not correlate with the MnSOD activity. Corresponding changes of MMP-2 activity after the addition of a NOS inhibitor (N(G)-amino-l-arginine) or a (.)NO donor ((Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate) to the cells suggested the possibility that (.)NO may be involved in the MnSOD-mediated MMP-2 activation pathway. These results indicate that MnSOD induces MMP-2 activity by regulation of intracellular ROS and imply that signaling pathways involving (.)NO may also be involved in the MnSOD mediation of MMP-2 activity.

Breast Neoplasms↗

PubMed2002

Overexpression of copper zinc superoxide dismutase suppresses human glioma cell growth.

Copper zinc superoxide dismutase (CuZnSOD) is an essential primary antioxidant enzyme that converts superoxide radical to hydrogen peroxide and molecular oxygen in the cytoplasm. Cytosolic glutathione peroxidase (GPx) converts hydrogen peroxide into water. The overall goal of the present study was to explore the possible role of the antioxidant enzyme CuZnSOD in expression of the malignant phenotype. We hypothesized that overexpression of CuZnSOD would lead to the suppression of at least part of the human malignant phenotype. To test this hypothesis, human CuZnSOD cDNA was transfected into U118-9 human malignant glioma cells. CuZnSOD activity levels increased 1.5-, 2.0-, 2.6-, and 3.5-fold, respectively, in four table transfected cell lines compared with wild type and vector controls. Overexpression of CuZnSOD altered cellular antioxidant enzyme profiles, including those of manganese superoxide dismutase, catalase, and GPx. The transfected clone with the highest CuZnSOD:GPx ratio (3.5) showed a 42% inhibition of tumor cell growth in vitro. The decreased rate of tumor cell growth in vitro was strongly correlated with the enzyme activity ratio of CuZnSOD:GPx. Glioma cells that stably overexpressed CuZnSOD demonstrated additional suppressive effects on the malignant phenotype when compared with the parental cells and vector controls. These cells showed decreased plating efficiency, elongated cell population doubling time, lower clonogenic fraction in soft agar, and, more significantly, inhibition of tumor formation in nude mice. This work suggested that CuZnSOD is a new tumor suppressor gene. Increased intracellular ROS levels were found in cells with high activity ratios of CuZnSOD:GPx. Change in the cellular redox status, especially change attributable to the accumulation of hydrogen peroxide or other hydroperoxides, is a possible reason to explain the suppression of tumor growth observed in CuZnSOD-overexpressing cells.

Animals↗

PubMed2002

Redox regulation of adenovirus-induced AP-1 activation by overexpression of manganese-containing superoxide dismutase.

Adenovirus gene therapy is a promising tool in the clinical treatment of many genetic and acquired diseases. However, it has also caused pathogenic effects in organs such as the liver. The redox-sensitive transcription factors AP-1 and NF-kappaB have been implicated in these effects. To study the mechanisms of adenovirus-mediated AP-1 and NF-kappaB activation and the possible involvement of oxidative stress in adenovirus transduction, rats were injected with either replication-defective recombinant adenovirus with DNA containing the cytomegalovirus promoter region only (AdCMV), adenovirus containing human manganese-containing superoxide dismutase (MnSOD) cDNA (AdMnSOD), or vehicle. Compared to vehicle and AdCMV transduction, MnSOD gene transfer yielded a fivefold increase in liver MnSOD activity 7 days postinjection. Gel shift assay showed that AdCMV transduction induced DNA binding activity for AP-1 but not NF-kappaB. MnSOD overexpression abolished this activation. Western blotting analysis of c-Fos and c-Jun suggested that up-regulation of c-fos and c-jun gene expression does not directly contribute to the induction of AP-1 activation. Glutathione/glutathione disulfide ratios were decreased by adenovirus transduction and restored by MnSOD overexpression. The AP-1 binding activity that was induced by AdCMV was decreased by immunoprecipitation of Ref-1 protein. Ref-1 involvement was confirmed by restoration of AP-1 binding activity after the immunoprecipitated Ref-1 protein had been added back. AP-1 DNA binding activity was also elevated in control and AdMnSOD-injected rats after addition of the immunoprecipitated Ref-1 protein. These data indicate that cellular transduction by recombinant adenovirus stimulates AP-1 DNA binding activity. Furthermore, our results suggest that MnSOD overexpression decreases AP-1 DNA binding activity by regulating intracellular redox status, with the possible involvement of Ref-1 in this redox-sensitive pathway.

Adenoviridae↗

PubMed2002

Selected contribution: Differential expression of stress-related genes with aging and hyperthermia.

Aging is associated with a reduced capacity to cope with physiological stress. To study the molecular mechanisms associated with the decline in stress tolerance that accompanies aging, differences in gene expression between young and old Fischer 344 rats under euthermic control conditions or in response to hyperthermic challenge were evaluated using a cDNA array containing 207 stress-related genes. In the nonstressed control condition, aging resulted in selective upregulation of stress protein genes and transcripts involved in cell growth, death, and signaling, along with a downregulation of genes involved in antioxidant defenses and drug metabolism. Heat stress resulted in a broad induction of genes in the antioxidant and drug metabolism categories and transcripts involved in DNA, RNA, and protein synthesis for both age groups. Old animals had a robust upregulation of genes involved in cell growth, death, and signaling after heat challenge, along with a blunted expression of stress-response genes. In contrast, young animals had a strong induction of stress-response genes after hyperthermic challenge. Changes in expression of selected genes were confirmed by RT-PCR analysis. These findings suggest that aging results in altered gene expression in response to heat stress that is indicative of decreased stress protein transcription and increased expression of oxidative stress-related genes. Thus our findings support the postulate that transcriptional changes in response to a physiological challenge such as hyperthermia contribute to the loss of stress tolerance in older organisms.

Aging↗