PubMed Health⌕ Search

Biomedical subjects

Hideki Ueno

Publications and source records attributed to Hideki Ueno.

At least 19 recordsLinked to original sources
PubMed2007

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Adult↗
PubMed2007

Potential prognostic benefit of lateral pelvic node dissection for rectal cancer located below the peritoneal reflection.

OBJECTIVE: To identify the parameters related to the effective selection of patients who could receive prognostic benefit from lateral pelvic node dissection. BACKGROUND: Accurate preoperative diagnosis of lateral nodal involvement (LNI) remains difficult, and the indications for lateral lymph node dissection have been controversial. PATIENTS AND METHODS: A total of 244 consecutive patients who underwent potentially curative surgery with lateral dissection for advanced lower rectal cancer (1985-2000) were reviewed. Patients were stratified into groups based on various parameters, and the therapeutic value index for survival benefit was compared among groups. The therapeutic index of lateral dissection was calculated by multiplying the frequency of metastasis to the lateral area and the cancer-related 5-year survival rate of patients with metastasis to the lateral area, irrespective of metastasis to other areas (mesorectal, superior rectal artery [SRA], and inferior mesenteric artery [IMA] areas). RESULTS: LNI was observed in 41 patients (17%); and 88% of them had nodal involvement in the region along the internal iliac/pudendal artery or in the obturator region ("vulnerable field"). The cancer-related 5-year survival rate among the patients with LNI was 42%; the therapeutic index for lateral dissection was calculated as 7.0 patients, which was much higher than that of lymphadenectomy of the SRA area (1.6 patients) and the IMA area (0.4 patients), and almost comparable to that of lymphadenectomy of the upward mesorectal area (6.9 patients). Although it was possible to select groups at high and low risk for LNI based on several parameters related to tumor aggressiveness, such as tumor differentiation in biopsy specimens, the therapeutic value index was not significantly different between these groups. Unlike these parameters, the diameter of the largest lymph node in the "vulnerable field," which was positively correlated with the rate of LNI but irrelevant to the prognosis, was able to successfully stratify patients by therapeutic index. CONCLUSIONS: Advanced lower rectal cancer patients having LNI in the lateral pelvic area are likely to receive prognostic benefit from lymphadenectomy. The most efficient means of determining the effectiveness of lateral dissection preoperatively is to estimate the nodal diameter in the "vulnerable" lateral regions by diagnostic imaging.

Disease-Free Survival↗
PubMed2007

Extramural cancer deposits without nodal structure in colorectal cancer: optimal categorization for prognostic staging.

To establish an optimal categorization of cancer deposits without lymph node structure (extranodal cancer deposits [EX]) in a prognostic staging system, we analyzed 1,027 cases in which patients underwent potentially curative surgery for advanced colorectal adenocarcinoma. EX was classified as vascular invasion-type (VAS) or non-VAS.A total of 512 foci of EX were identified in 205 patients (20.0%), with VAS and non-VAS found in 68 and 182 patients, respectively. The hazard ratio for patients with nodal involvement was 3.6 and for patients with VAS and non-VAS, 2.5 and 4.7, respectively. Based on multivariate analysis of these 3 parameters, only nodal involvement and non-VAS were significant prognosticators. By using the Akaike information criterion, N staging was capable of predicting survival outcome with the highest accuracy when both nodal involvement and non-VAS were treated together as an N factor and VAS was treated as a T factor ("new categorization"). The clinical significance of the TNM grading system for colorectal cancer would be enhanced if we treat EX as a new categorization.

Adult↗
PubMed2006

Early phase II study of uracil-tegafur plus doxorubicin in patients with unresectable advanced biliary tract cancer.

BACKGROUND: Standard chemotherapy for advanced biliary tract cancer has not been established. The purpose of this study was to evaluate the efficacy and toxicity of a combination chemotherapy of uracil-tegafur (UFT) and doxorubicin in patients with unresectable advanced biliary tract cancer. METHODS: Patients with histologically or cytologically confirmed, measurable biliary tract cancer, including intrahepatic or extrahepatic cholangiocarcinoma, gallbladder cancer and ampulla of Vater cancer, which was not amenable to surgery, were eligible for the study. Patients received oral UFT 300 mg/m(2) per day divided into two doses on Days 1-14 and intravenous doxorubicin 30 mg/m(2) on Day 1. This cycle was repeated every 21 days. Additional courses of this regimen were given until a maximum of 15 courses, disease progression or the appearance of unacceptable toxicity. RESULTS: Twenty-four patients from five institutions were enrolled between March 2004 and November 2004. Of the 24 patients, three had partial responses for an objective response rate of 12.5% (95% confidence interval, 2.7-32.4%), 13 patients had stable disease, 7 had progressive disease and the final patient was not evaluated. Grade 3 toxicity was observed in 5 of the 24 patients (20.8%), and these toxicities included anorexia, fatigue, anemia and neutropenia. None had grade 4 toxicity. The median progression-free and overall survival time was 2.5 and 7.6 months, respectively. CONCLUSIONS: Combination chemotherapy of UFT and doxorubicin was well tolerated and showed preliminary moderate activity against advanced biliary tract cancer. Further investigation in a late phase II study involving a large number of patients is recommended.

Aged↗
PubMed2006

A phase I/II study of combination chemotherapy with gemcitabine and 5-fluorouracil for advanced pancreatic cancer.

BACKGROUND: In an effort to improve efficacy of single-agent gemcitabine in pancreatic cancer, several studies have examined the effects of 5-FU combined with gemcitabine. However, no studies to date have been performed in Japanese patients. We thus conducted a phase I/II study of gemcitabine and infusional 5-FU in Japanese patients to determine a recommended dosage for this combination and clarify efficacy and toxicity. METHODS: Phase I evaluated the frequency of dose limiting toxicity of two 5-FU dosages (400 and 500 mg/m(2)/day) infused continuously over 5 days combined with gemcitabine 1000 mg/m(2) x 3 every 4 weeks. Results from phase I determined the recommended dosage to be examined in phase II for effect on survival period, clinical benefit response (CBR), tumor response and safety. RESULTS: A total of 34 chemo-naive patients were entered into the study. All had a Karnofsky performance of > or =50 points and distant metastases. Dose limiting toxicities in phase I determined the recommended 5-FU dosage at 400 mg/m(2)/day. Grade 3-4 hematological toxicities (neutropenia, leukopenia and thrombocytopenia) were the most common severe toxicities. For the 28 patients administered the recommended dosage, 1-year survival rate was 14.3%, median survival time 7.1 months and progression free survival 3.2 months. Seven patients achieved a 25% overall response rate and three showed 27.3% improvement in CBR. CONCLUSION: Although a meaningful survival benefit over single-agent gemcitabine was not demonstrated, 5-FU 400 mg/m(2)/day infused continuously over 5 days in combination with gemcitabine 1000 mg/m(2) x 3 every 4 weeks appeared to be a moderately effective palliative treatment with low toxicity in Japanese patients with metastatic pancreatic cancer.

Adult↗
PubMed2006

A phase II study of weekly irinotecan as first-line therapy for patients with metastatic pancreatic cancer.

PURPOSE: The aim of this study was to assess the efficacy and toxicity of weekly irinotecan in patients with metastatic pancreatic cancer. PATIENTS AND METHODS: Patients with histologically proven pancreatic adenocarcinoma, at least one bidimensionally measurable metastatic lesion, and no prior chemotherapy were selected. Irinotecan at a dose of 100 mg/m2 was administered intravenously for 90 min on days 1, 8, and 15 every 4 weeks until disease progression or unacceptable toxicity. Pharmacokinetics was examined on day 1 of the first cycle of treatment. RESULTS: Thirty-seven of 40 enrolled patients were assessable for efficacy and toxicity. A partial response was obtained in 10 patients, giving an overall response rate of 27.0% (95% confidence interval 13.8-44.1%). The median overall survival was 7.3 months with a 1-year survival rate of 29.5%. Although toxicities were generally tolerated, one patient died of disseminated intravascular coagulation syndrome induced by neutropenia with watery diarrhea. Pharmacokinetic study showed that patients with biliary drainage seemed to have higher area under the concentration versus time curve for irinotecan and its metabolites compared with patients without biliary drainage. CONCLUSION: Single-agent irinotecan has significant efficacy for metastatic pancreatic cancer. The toxicity with this schedule appears manageable, though it must be monitored carefully.

Adult↗
PubMed2006

T1 neuroendocrine carcinoma of anal canal after transanal resection for intramucosal adenocarcinoma.

Neuroendocrine carcinomas of the anal canal are rare, representing 1% of malignant tumors of the anal canal. This tumor behaves aggressively and leads to poor outcomes. The majority of tumors are found with distant metastases. We describe the case of a 63-year-old female with T1 neuroendocrine carcinoma of the anal canal arising from the site of a previous transanal excision performed 13 months earlier for intramucosal adenocarcinoma of the anal canal. The patient did not have any distant metastases on preoperative computed tomography and magnetic resonance imaging. She underwent abdominoperineal resection after the initial diagnostic transanal excision of the neuroendocrine carcinoma, which had shown submucosal invasion. No lymph node metastasis was found in pathological examination. In this case, it is likely that the neuroendocrine tumor, which infiltrated into the submucosal layer with venous invasion, had developed over the intervening 13 months following the original transanal excision of the adenocarcinoma.

Adenocarcinoma↗
PubMed2006

Spontaneous regression of hepatocellular carcinoma.

We report four patients with hepatocellular carcinoma (all men, with liver cirrhosis and hepatitis C virus infections) who showed spontaneous regression of the tumor. When the spontaneous regression occurred all of the patients were over age 67 years. They showed a rapid increase of serum alpha-fetoprotein levels just before the spontaneous regression of hepatocellular carcinoma. In all the patients, the alpha-fetoprotein level decreased to within normal limits and the tumor was partially to completely reduced in size. One patient revealed regression after bleeding of esophageal varices and blood transfusion. Another showed spontaneous regression after taking several complementary and alternative medicines. However, the mechanisms underlying this intriguing phenomenon remain unknown.

Aged↗
PubMed2006

Tumor buds show reduced expression of laminin-5 gamma 2 chain in DNA mismatch repair deficient colorectal cancer.

PURPOSE: Tumor budding at the invasive margin of colorectal cancer is an important adverse prognostic factor. The subset of colorectal cancer that is deficient in DNA mismatch repair has been associated with a good prognosis. It is hypothesized that tumor budding in this subset may lack biologic aggressiveness because it is not associated with aberrant expression of the independent prognostic factor, laminin-5 gamma 2. METHODS: Eighty colorectal cancers with high-grade tumor budding were studied, including nine sporadic colorectal cancers with immunohistochemical loss of expression of MLH1 (MLH1(-)), seven colorectal cancers from patients with hereditary nonpolyposis colorectal cancer, and 64 sporadic colorectal cancers expressing both MLH1 and MSH2 (MLH1(+)). Two regulatory mechanisms for laminin-5 gamma 2 expression were explored, including aberrant nuclear expression of beta-catenin by immunohistochemistry and promoter methylation of laminin-5 gamma 2 by methylation-specific polymerase chain reaction. RESULTS: Only three of nine MLH1(-) colorectal cancers showed expression of laminin-5 gamma 2 compared with 46 of 64 MLH1(+) colorectal cancers (P = 0.05). Only two of seven hereditary nonpolyposis colorectal cancers expressed laminin-5 gamma 2 compared with MLH1(+) colorectal cancers (P= 0.03). Expression of nuclear beta-catenin was more frequent (58 percent) in MLH1(+) colorectal cancers compared with MLH1(-) colorectal cancers (11 percent, P = 0.01). Methylation of laminin-5 gamma 2 was found in 5 of 38 (13 percent) cases but did not differ among colorectal cancer subsets. Four of five colorectal cancers with methylation of laminin-5 gamma 2 were scored as negative for laminin-5 gamma 2 by immunohistochemistry. CONCLUSIONS: The reduced expression of laminin-5 gamma 2 in colorectal cancers with deficient DNA mismatch repair may underlie a variant of tumor budding that is relatively nonaggressive.

Adaptor Proteins, Signal Transducing↗
PubMed2006

Differential prognostic significance of morphologic invasive markers in colorectal cancer: tumor budding and cytoplasmic podia.

PURPOSE: In colorectal cancer, the presence of cytoplasmic podia around tumor budding foci may be a morphologic marker for an activated budding phenotype that is associated with cell motility. In this study, we have investigated the prognostic significance of cytoplasmic podia. METHODS: A total of 136 pT3 colorectal cancers were classified according to extent of budding and cytoplasmic podia as identified by immunostaining for cytokeratin. The prognostic significance of budding and cytoplasmic podia was then assessed. RESULTS: The overall survival curves between the groups with high-grade and low-grade cytoplasmic podia were different (5-year survival rates were 60.5 and 83.8 percent respectively, P = 0.0003). Similar results were shown for tumor budding (59.8 and 87.7 percent, P < 0.0001). Multivariate analysis showed that the grades of cytoplasmic podia (hazards ratio, 2.4; P = 0.012) and budding (hazards ratio, 2.3; P = 0.024) were independent prognostic factors. Additionally, among colorectal cancers with high-grade budding, the grade of cytoplasmic podia was selected as an independent prognostic factor (hazards ratio, 2.4; P = 0.042). CONCLUSIONS: Cytoplasmic podia and budding are related but independent pathologic predictive markers in patients with resected pT3 colorectal cancer.

Aged↗
PubMed2006

Distribution of lymph node metastasis is a prognostic index in patients with stage III colon cancer.

BACKGROUND: In the TNM classification of colorectal carcinoma, N-staging is dependent on the number of metastases; in the Japanese classification system, staging usually has been based on the distribution of metastases (N1, paracolic; N2, along the major vessels; N3, at the root of major vessels). The aim of our study was to examine whether the concept of the distribution of nodal metastasis could improve the TNM classification for colorectal cancer. METHODS: We studied the survival rates of 485 and 136 patients with stage III colonic and rectal cancer, respectively, who underwent curative surgery between 1979 and 1998. The patients were categorized into 4 groups: group 1, TNM-N1 classified in J-N1; group 2, TNM-N2 in J-N1; group 3, TNM-N1 in J-N2-3; and group 4, TNM-N2 in J-N2-3. RESULTS: In the colon cancer arm, the 5-year survival rates of the patients in groups 1 to 4 were 74%, 51%, 52%, and 54%, respectively. There was a significant difference in survival rate between groups 1 and 3 (P = .0002). Thus, in colon cancer, nodal metastasis along the major vessels was a bad prognostic factor, even though the number of nodes that were involved was <4. In the rectum cancer arm, the 5-year survival rates of the patients in each group were 65%, 39%, 60%, and 32%, respectively. Only the number of nodal metastases was an independently significant prognostic variable. CONCLUSION: This study suggests that adding the concept of nodal distribution to the conventional TNM staging of colon cancer will improve the accuracy in the evaluation of the nodal status.

Adult↗
PubMed2006

Extent of mesorectal tumor invasion as a prognostic factor after curative surgery for T3 rectal cancer patients.

OBJECTIVE: To determine the significance of the extent of mesorectal tumor invasion as a prognostic factor for T3 rectal cancer patients. SUMMARY BACKGROUND DATA: There is controversy as to which primary lesion characteristics, other than regional lymph node involvement, in T3 rectal cancer are reliable prognostic factors. PATIENTS AND METHODS: The extent of mesorectal tumor invasion was evaluated using 2 data sets comprising 196 and 247 patients undergoing curative surgery at separate institutes. When the outer aspect of the muscular layer was not identifiable, an estimate was obtained by drawing a straight line between the 2 break points of the muscular layer. RESULTS: We selected 6 mm as the optimal value for subclassification of T3 rectal patients into 2 groups, based on the extent of mesorectal invasion, using the first data set. The overall 5-year survival rate was significantly higher in patients with <6 mm than in those with > or =6 mm of mesorectal invasion (72% versus 50%; P< 0.01). Similarly, in the second data set, the overall 5-year survival rates of patients with mesorectal invasion <6 mm and > or =6 mm were 59% and 37%, respectively (P < 0.01). In both data sets, multivariate analyses verified the extent of mesorectal invasion to be an independent prognostic factor, together with nodal involvement. Regarding positive nodal involvement and mesorectal invasion > or =6 mm as risk factors, the overall 5-year survival rates with none, one, and both of these factors were 84%, 61%, and 38%, respectively, in the first data set (P < 0.01). Prognostic results were similar for the second data set. CONCLUSION: Extent of mesorectal invasion, based on a 6-mm cutoff value, is useful for subclassification of T3 rectal cancer patients.

Adult↗
PubMed2006

Randomized, double-blind, placebo-controlled trial of bovine lactoferrin in patients with chronic hepatitis C.

Several studies have suggested that lactoferrin administration may decrease the serum level of hepatitis C virus (HCV) RNA in patients with chronic hepatitis C. The aim of the present study was to confirm the efficacy of orally administered bovine lactoferrin (bLF) in patients with chronic hepatitis C. The patients with chronic hepatitis C randomly received either oral bLF at a dose of 1.8 g daily for 12 weeks, or an oral placebo. The primary endpoint was the virologic response, defined as a 50% or greater decrease in serum HCV RNA level at 12 weeks compared with the baseline. The secondary endpoint was the biochemical response, which was defined as a 50% or greater decrease in the serum alanine aminotransferase (ALT) level at 12 weeks compared with the baseline. One hundred and ninety-eight of 199 patients were evaluable for efficacy and safety. bLF treatment was well tolerated and no serious toxicities were observed. A virologic response was achieved in 14 of 97 patients (14.4%) in the bLF group, and 19 of 101 (18.8%) in the placebo group. There was no significant difference in virologic response rates between the two groups (-4.4%, 95% confidence interval -14.8, 6.1). In addition, bLF intake did not have any favorable effect on the serum ALT level. The virologic responses were not different between two groups in any subgroup analysis. In conclusion, orally administered bLF does not demonstrate any significant efficacy in patients with chronic hepatitis C.

Administration, Oral↗
PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗
PubMed2006

[An autopsied case of schizophrenic patient who died from heat stroke].

A male residual schizophrenic out-patient of 65 years old had presented "heat stroke" and died in progressive course of 7 months. His mental condition had been stable and he had kept good drug compliance. In some summer day, he presented high fever and confusion, followed by convulsion. He showed over 40 degrees C high temperature (max 42 degrees C) for about 6 hours. After 10 day's high serum CPK, he gradually presented severe muscle atrophy (proximal dominant), flaccid quadriplegia and brain atrophy (especially in cerebellum). He died from pneumonia. His brain weight was 1,350g. Neuropathological study showed severe loss of Purkinje cell with gliosis. Neurons in dentate nucleus ware entirely lost and a great amount of fatty macrophages were present around the dentate nucleus. Fatty macrophages were observed from cerebellum to red nucleus through superior cerebellar peduncle. These findings have been known as findings of heat stroke. Addition to these findings, this case presented a neuronal loss in the substantita nigra and in the anterior horn of spinal cord and the degeneration of bilateral pyramidal tract. These findings have not been thus far reported, so this case is thought to be the valuable case on considering the variation of neuropathology of "heat stroke".

Aged↗