PubMed Health⌕ Search

Biomedical subjects

Hiromi Nakanishi

Publications and source records attributed to Hiromi Nakanishi.

18 recordsLinked to original sources
PubMed2006

Cloning and characterization of deoxymugineic acid synthase genes from graminaceous plants.

Graminaceous plants have evolved a unique mechanism to acquire iron through the secretion of a family of small molecules, called mugineic acid family phytosiderophores (MAs). All MAs are synthesized from l-Met, sharing the same pathway from l-Met to 2'-deoxymugineic acid (DMA). DMA is synthesized through the reduction of a 3''-keto intermediate by deoxymugineic acid synthase (DMAS). We have isolated DMAS genes from rice (OsDMAS1), barley (HvDMAS1), wheat (TaD-MAS1), and maize (ZmDMAS1). Their nucleotide sequences indicate that OsDMAS1 encodes a predicted polypeptide of 318 amino acids, whereas the other three orthologs all encode predicted polypeptides of 314 amino acids and are highly homologous (82-97.5%) to each other. The DMAS proteins belong to the aldo-keto reductase superfamily 4 (AKR4) but do not fall within the existing subfamilies of AKR4 and appear to constitute a new subfamily within the AKR4 group. All of the proteins showed DMA synthesis activity in vitro. Their enzymatic activities were highest at pH 8-9, consistent with the hypothesis that DMA is synthesized in subcellular vesicles. Northern blot analysis revealed that the expression of each of the above DMAS genes is up-regulated under iron-deficient conditions in root tissue, and that of the genes OsDMAS1 and TaDMAS1 is up-regulated in shoot tissue. OsDMAS1 promoter-GUS analysis in iron-sufficient roots showed that its expression is restricted to cells participating in long distance transport and that it is highly up-regulated in the entire root under iron-deficient conditions. In shoot tissue, OsDMAS1 promoter drove expression in vascular bundles specifically under iron-deficient conditions.

Amino Acid Sequence↗
PubMed2006

Isolation and characterization of IRO2, a novel iron-regulated bHLH transcription factor in graminaceous plants.

To clarify the molecular mechanism that regulates iron (Fe) acquisition in graminaceous plants, a time-course analysis of gene expression during Fe deficiency stress was conducted using a rice 22K oligo-DNA microarray. Twenty-one genes for proteins that function in gene regulation were induced by Fe deficiency. Of these genes, a putative basic helix-loop-helix (bHLH) transcription factor gene, named OsIRO2, was strongly expressed in both roots and shoots during Fe deficiency stress. The expression of OsIRO2 was induced exclusively by Fe deficiency, and not by deficiencies in other metals. Expression of the barley HvIRO2 gene, which is a homologue of OsIRO2, was also induced by Fe deficiency. An in silico search revealed that IRO2 is highly conserved among graminaceous plants, which include wheat, sorghum, and maize. The cyclic amplification and selection of targets (CASTing) technique revealed that OsIRO2 bound preferentially to the sequence 5'-ACCACGTGGTTTT-3', and the electrophoretic mobility shift assay revealed 5'-CACGTGG-3' as the core sequence for OsIRO2 binding. Sequences similar to the OsIRO2-binding sequence were found upstream of several genes that are involved in Fe acquisition, such as OsNAS1, OsNAS3, OsIRT1, OsFDH, OsAPT1, and IDS3. The core sequence of the OsIRO2-binding sequence occurred more frequently in the upstream regions of Fe deficiency-inducible genes than in the corresponding regions of non-inducible genes. These results suggest that IRO2 is involved in the regulation of gene expression under Fe-deficient conditions.

Amino Acid Sequence↗
PubMed2006

Rice plants take up iron as an Fe3+-phytosiderophore and as Fe2+.

Only graminaceous monocots possess the Strategy II iron (Fe)-uptake system in which Fe is absorbed by roots as an Fe3+-phytosiderophore. In spite of being a Strategy II plant, however, rice (Oryza sativa) contains the previously identified Fe2+ transporter OsIRT1. In this study, we isolated the OsIRT2 gene from rice, which is highly homologous to OsIRT1. Real-time PCR analysis revealed that OsIRT1 and OsIRT2 are expressed predominantly in roots, and these transporters are induced by low-Fe conditions. When expressed in yeast (Saccharomyces cerevisiae) cells, OsIRT2 cDNA reversed the growth defects of a yeast Fe-uptake mutant. This was similar to the effect of OsIRT1 cDNA. OsIRT1- and OsIRT2-green fluorescent protein fusion proteins localized to the plasma membrane when transiently expressed in onion (Allium cepa L.) epidermal cells. OsIRT1 promoter-GUS analysis revealed that OsIRT1 is expressed in the epidermis and exodermis of the elongating zone and in the inner layer of the cortex of the mature zone of Fe-deficient roots. OsIRT1 expression was also detected in the ccompanion cells. Analysis using the positron-emitting tracer imaging system showed that rice plants are able to take up both an Fe3+-phytosiderophore and Fe2+. This result indicates that, in addition to absorbing an Fe3+-phytosiderophore, rice possesses a novel Fe-uptake system that directly absorbs the Fe2+, a strategy that is advantageous for growth in submerged conditions.

Amino Acid Sequence↗
PubMed2006

Biosynthesis and secretion of mugineic acid family phytosiderophores in zinc-deficient barley.

Mugineic acid family phytosiderophores (MAs) are metal chelators that are produced in graminaceous plants in response to iron (Fe) deficiency, but current evidence regarding secretion of MAs during zinc (Zn) deficiency is contradictory. Our studies using HPLC analysis showed that Zn deficiency induces the synthesis and secretion of MAs in barley plants. The levels of the HvNAS1, HvNAAT-A, HvNAAT-B, HvIDS2 and HvIDS3 transcripts, which encode the enzymes involved in the synthesis of MAs, were increased in Zn-deficient roots. Studies of the genes involved in the methionine cycle using microarray analysis showed that the transcripts of these genes were increased in both Zn-deficient and Fe-deficient barley roots, probably allowing the plant to meet its demand for methionine, a precursor in the synthesis of MAs. In addition, HvNAAT-B transcripts were detected in Zn-deficient shoots, but not in those that were deficient in Fe. Increased synthesis of MAs in Zn-deficient barley was not due to a deficiency of Fe, because Zn-deficient barley accumulated more Fe than did the control plants, ferritin transcripts were increased in Zn-deficient plants, and Zn deficiency promoted Fe transport from root to shoot. Moreover, analysis using the positron-emitting tracer imaging system (PETIS) confirmed that more 62Zn(II)-MAs than 62Zn2+ were absorbed by the roots of Zn-deficient barley plants. These data suggest that the increased biosynthesis and secretion of MAs arising from a shortage of Zn are not due to an induced Fe deficiency, and that secreted MAs are effective in absorbing Zn from the soil.

Azetidinecarboxylic Acid↗
PubMed2006

Metabolic engineering of Saccharomyces cerevisiae producing nicotianamine: potential for industrial biosynthesis of a novel antihypertensive substrate.

Nicotianamine (NA), a metal chelator, is ubiquitous in higher plants. In humans, NA inhibits angiotensin I-converting enzyme (ACE), and consequently reduces high blood pressure. Nicotianamine is synthesized from the trimerization of S-adenosylmethionine (SAM) by NA synthase (NAS). Here, we aimed to produce large amounts of NA fermentatively by introducing the Arabidopsis AtNAS2 gene into Saccharomyces cerevisiae strain SCY4. This strain can accumulate up to 100 times the usual amount of SAM, and this is considered desirable for overproduction of NA. Nicotianamine was produced in the engineered yeast, and the NA level increased with incubation time until the stationary phase. The maximum concentration of intracellular NA obtained was 766+/-33 microg/g wet weight. Successful production of NA in S. cerevisiae should pave the way for industrial production of this novel antihypertensive substrate.

Alkyl and Aryl Transferases↗
PubMed2005

OsZIP4, a novel zinc-regulated zinc transporter in rice.

Zinc (Zn) is an essential element for the normal growth of plants but information is scarce on the mechanisms whereby Zn is transported in rice (Oryza sativa L.) plants. Four distinct genes, OsZIP4, OsZIP5, OsZIP6, and OsZIP7 that exhibit sequence similarity to the rice ferrous ion transporter, OsIRT1, were isolated. Microarray and northern blot analysis revealed that OsZIP4 was highly expressed under conditions of Zn deficiency in roots and shoots. Real-time-PCR revealed that the OsZIP4 transcripts were more abundant than those of OsZIP1 or OsZIP3 in Zn-deficient roots and shoots. OsZIP4 complemented a Zn-uptake-deficient yeast (Saccharomyces cerevisiae) mutant, Deltazrt1,Deltazrt2, indicating that OsZIP4 is a functional transporter of Zn. OsZIP4-synthetic green fluorescent protein (sGFP) fusion protein was transiently expressed in onion epidermal cells localized to the plasma membrane. In situ hybridization analysis revealed that OsZIP4 in Zn-deficient rice was expressed in shoots and roots, especially in phloem cells. Furthermore, OsZIP4 transcripts were detected in the meristem of Zn-deficient roots and shoots. These results suggested that OsZIP4 is a Zn transporter that may be responsible for the translocation of Zn within rice plants.

Carrier Proteins↗
PubMed2005

Increased nicotianamine biosynthesis confers enhanced tolerance of high levels of metals, in particular nickel, to plants.

Nicotianamine, a plant-derived chelator of metals, is produced by the trimerization of S-adenosylmethionine catalyzed by nicotianamine synthase. We established transgenic Arabidopsis and tobacco plants that constitutively overexpress the barley nicotianamine synthase gene. Nicotianamine synthase overexpression resulted in increased biosynthesis of nicotianamine in transgenic plants, which conferred enhanced tolerance of high levels of metals, particularly nickel, to plants. Promoter activities of four nicotianamine synthase genes in Arabidopsis were all increased in response to excess nickel, suggesting that nicotianamine plays an important role in the detoxification of nickel in plants. Furthermore, transgenic tobacco plants with a high level of nicotianamine grew well in a nickel-enriched serpentine soil without developing any symptoms of nickel toxicity. Our results indicate that nicotianamine plays a critical role in metal detoxification, and this can be a powerful tool for use in phytoremediation.

Adaptation, Physiological↗
PubMed2005

Expression of iron-acquisition-related genes in iron-deficient rice is co-ordinately induced by partially conserved iron-deficiency-responsive elements.

Rice plants (Oryza sativa L.) utilize the iron chelators known as mugineic acid family phytosiderophores (MAs) to acquire iron from the rhizosphere. Synthesis of MAs and uptake of MA-chelated iron are strongly induced under conditions of iron deficiency. Microarray analysis was used to characterize the expression profile of rice in response to iron deficiency at the genomic level. mRNA extracted from iron-deficient or iron-sufficient rice roots or leaves was hybridized to a rice array containing 8987 cDNA clones. An induction ratio of greater than 2.0 in roots was observed for 57 genes, many of which are involved in iron-uptake mechanisms, including every identified or predicted step in the methionine cycle and the biosynthesis of MAs from methionine. Northern analysis confirmed that the expression of genes encoding every step in the methionine cycle is thoroughly induced by iron deficiency in roots, and almost thoroughly induced in leaves. A promoter search revealed that the iron-deficiency-induced genes related to iron uptake possessed sequences homologous to the iron-deficiency-responsive cis-acting elements IDE1 and IDE2 in their promoter regions, at a higher rate than that showing no induction under Fe deficiency. These results suggest that rice genes involved in iron acquisition are co-ordinately regulated by conserved mechanisms in response to iron deficiency, in which IDE-mediated regulation plays a significant role.

Blotting, Northern↗
PubMed2004

OsYSL2 is a rice metal-nicotianamine transporter that is regulated by iron and expressed in the phloem.

We identified 18 putative yellow stripe 1 (YS1)-like genes (OsYSLs) in the rice genome that exhibited 36-76% sequence similarity to maize iron(III)-phytosiderophore transporter YS1. Of particular interest was OsYSL2, the transcripts of which were not detected in the roots of either iron-sufficient or iron-deficient plants, but dramatic expression was induced in the leaves by iron deficiency. Based on the nucleotide sequence, OsYSL2 was predicted to encode a polypeptide of 674 amino acids containing 14 putative transmembrane domains. OsYSL2:green fluorescent protein (GFP) was localized in the plasma membrane of onion epidermal cells. Promoter:beta-glucuronidase (GUS) analysis revealed that OsYSL2 was expressed in companion cells in iron-sufficient roots. GUS activity was increased in companion cells, but no GUS staining was observed in epidermal or cortex cells, even in iron-deficient roots. In the leaves and leaf sheaths of iron-sufficient rice, GUS staining was observed in phloem cells of the vascular bundles. In iron-deficient leaves, the OsYSL2 promoter was active in all tissues with particularly strong GUS activity evident in companion cells. The phloem-specific expression of the OsYSL2 promoter suggests that OsYSL2 is involved in the phloem transport of iron. Strong OsYSL2 promoter activity was also detected in developing seeds. Electrophysiological measurements using Xenopus laevis oocytes showed that OsYSL2 transported iron(II)-nicotianamine (NA) and manganese(II)-NA, but did not transport iron(III)-phyosiderophore. These results suggest that OsYSL2 is a rice metal-NA transporter that is responsible for the phloem transport of iron and manganese, including the translocation of iron and manganese into the grain.

Amino Acid Sequence↗
PubMed2003

Three rice nicotianamine synthase genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in long-distance transport of iron and differentially regulated by iron.

Nicotianamine (NA), a chelator of metals, is ubiquitously present in higher plants. In graminaceous plants, NA is a biosynthetic precursor of phytosiderophores and is thus a crucial component for iron (Fe) acquisition. Here, we show that three rice NA synthase (NAS) genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in long-distance transport of Fe and that the three genes are differentially regulated by Fe. OsNAS1 and OsNAS2 transcripts were detected in Fe-sufficient roots but not in leaves, and levels of both increased markedly in both roots and leaves in response to Fe deficiency. In contrast, the OsNAS3 transcript was present in leaves but was very low in roots of Fe-sufficient plants. Further, OsNAS3 expression was induced in roots but was suppressed in leaves in response to Fe deficiency. Promoter-GUS analysis revealed that OsNAS1 and OsNAS2 were expressed in Fe-sufficient roots in companion cells and pericycle cells adjacent to the protoxylem. With Fe deficiency, OsNAS1 and OsNAS2 expression extended to all root cells along with an increase in phytosiderophore secretion. In Fe-deficient plants, OsNAS1 and OsNAS2 were expressed in the vascular bundles of green leaves and in all cells of leaves showing severe chlorosis. OsNAS3 expression was restricted to the pericycle and companion cells of the roots, and in companion cells of leaves irrespective of Fe status. These results strongly suggested that NAS and NA play an important role in long-distance transport of Fe in rice plants, in addition to their roles in phytosiderophore secretion from roots.

Alkyl and Aryl Transferases↗
PubMed2003

Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants.

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

Base Sequence↗
PubMed2003

Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

Alkyl and Aryl Transferases↗
PubMed2003

Role of nicotianamine in the intracellular delivery of metals and plant reproductive development.

Nicotianamine (NA), a chelator of metals, is ubiquitously present in higher plants. Nicotianamine aminotransferase (NAAT) catalyzes the amino group transfer of NA in the biosynthetic pathway of phytosiderophores and is essential for iron acquisition in graminaceous plants. The gene that encodes NAAT from barley was introduced into the nongraminaceous plant tobacco, which produces NA but not phytosiderophores. Transgenic tobacco plants (naat tobacco) that constitutively expressed the NAAT gene had young leaves with interveinal chlorosis and flowers that were abnormally shaped and sterile. Endogenous NA was consumed as a result of NAAT overproduction in naat tobacco. The resulting NA shortage caused disorders in internal metal transport, leading to these abnormal phenotypes. In addition to its role in long-distance metal transport, NA may be involved in the regulation of metal transfer within the cells. These results suggest that a shortage of NA impaired the functions of metal-requiring proteins, including transcription factors.

Alkyl and Aryl Transferases↗
PubMed2002

cDNA microarray analysis of gene expression during Fe-deficiency stress in barley suggests that polar transport of vesicles is implicated in phytosiderophore secretion in Fe-deficient barley roots.

To acquire Fe from soil, graminaceous plants secrete mugineic acid family phytosiderophores (MAs) from their roots. The secretion of MAs increases in response to Fe deficiency, and shows a distinct diurnal rhythm. We used a microarray that included 8987 cDNAs of rice EST clones to examine gene expression profiles in barley roots during Fe-deficiency stress. Approximately 200 clones were identified as Fe-deficiency-inducible genes, of which seven had been identified previously. In order to meet the increased demand for methionine to produce MAs, Fe-deficiency enhances the expression of genes that participate in methionine synthesis, as well as recycling methionine through the Yang cycle. Of these 200 genes, approximately 50 exhibited different transcription levels in Fe-deficient roots at noon and at night. Northern blot analysis of time course experiments confirmed that five of these genes exhibited a diurnal change in their level of expression. The diurnal changes in the expression of these genes suggest that polar vesicle transport is involved in the diurnal secretion of MAs.

Azetidinecarboxylic Acid↗
PubMed2002

IDI7, a new iron-regulated ABC transporter from barley roots, localizes to the tonoplast.

A new Fe-deficiency-induced cDNA, IDI7, was isolated from the roots of Fe-deficient barley (Hordeum vulgare L. cv. Ehimehadaka no. 1). The transcript levels of IDI7 in roots strongly correlated with iron nutritional status, and induction by Fe-deficiency was restricted to roots. Excess treatment with heavy metal ions, such as copper, manganese, and zinc, did not cause obvious IDI7 induction in either leaves or roots. IDI7 encodes a 644 amino acid protein, and has features typical of ATP-binding cassette (ABC) transporters. Phylogenetic analysis revealed that IDI7 is closely related to the half-type ABC protein subfamily, which includes mammalian transporters associated with antigen processing (TAPs). A transiently expressed fusion protein of IDI7 to green fluorescent protein (GFP) was localized to tonoplasts in suspension-cultured tobacco (Nicotiana tabacum L.) cells. IDI7 and its orthologues are thought to comprise a new class of ABC transporters, located in the tonoplasts of higher plants. A possible Fe-deficiency adaptation role for IDI7 in barley root cells, involving transport across the tonoplast, is proposed.

ATP-Binding Cassette Transporters↗
PubMed2002

Cloning an iron-regulated metal transporter from rice.

Rice cDNA and genomic libraries were screened in order to clone an Fe(II) transporter gene. A cDNA clone highly homologous to the Arabidopsis Fe(II) transporter gene IRT1 was isolated from Fe-deficient rice roots. The cDNA clone was named OsIRT1. A genomic clone corresponding to the cDNA was also obtained, sequenced and analysed. When expressed in yeast cells, OsIRT1 cDNA reversed the growth defects of the yeast iron-uptake mutant. Northern blot analysis revealed that OsIRT1 mRNA was predominantly expressed in roots and was induced by Fe- and Cu-deficiency. This suggests that OsIRT1 is a functional metal transporter for iron, and is actively engaged in Fe uptake from soils, especially under limiting conditions.

Amino Acid Sequence↗