Biomedical subjects

Hironobu Minami

Publications and source records attributed to Hironobu Minami.

At least 19 recordsLinked to original sources

PubMed2007

Multifaceted psychosocial intervention program for breast cancer patients after first recurrence: feasibility study.

We developed a novel multifaceted psychosocial intervention program which involves screening for psychological distress and comprehensive support including individually tailored psychotherapy and pharmacotherapy provided by mental health professionals. The purpose of the present study was to investigate the feasibility of the intervention program and its preliminary usefulness for reducing clinical psychological distress experienced by patients with recurrent breast cancer. The subjects who participated in the 3 months intervention program completed psychiatric diagnostic interview and several self-reported measures regarding psychological distress, traumatic stress, and quality of life. The assessments were conducted before the intervention (T1), after the intervention (T2), and 3 months after the intervention (T3). A total of 50 patients participated in the study. The rates of participation in and adherence to the intervention program were 85 and 86%, respectively. While the proportion of psychiatric disorders at T2 (11.6%) was not significantly different from that at T1 (22.0%) (p = 0.15), the proportion of that at T3 (7.7%) had significantly decreased compared with that at T1 (p = 0.005). The novel intervention program is feasible, is a promising strategy for reducing clinically manifested psychological distress and further controlled studies are warranted.

Adult↗

PubMed2006

Dofequidar fumarate (MS-209) in combination with cyclophosphamide, doxorubicin, and fluorouracil for patients with advanced or recurrent breast cancer.

PURPOSE: To evaluate the efficacy and tolerability of dofequidar plus cyclophosphamide, doxorubicin, and fluorouracil (CAF) therapy in comparison with CAF alone, in patients with advanced or recurrent breast cancer. Dofequidar is a novel, orally active quinoline derivative that reverses multidrug resistance. PATIENTS AND METHODS: In this randomized, double-blind, placebo-controlled trial, patients were treated with six cycles of CAF therapy: 28 days/cycle, with doxorubicin (25 mg/m2) and fluorouracil (500 mg/m2) administered on days 1 and 8 and cyclophosphamide (100 mg orally [PO]) administered on day 1 through 14. Patients received dofequidar (900 mg PO) 30 minutes before each dose of doxorubicin. Primary end point was overall response rate (ORR; partial or complete response). In total, 221 patients were assessable. RESULTS: ORR was 42.6% for CAF compared with 53.1% for dofequidar + CAF, a 24.6% relative improvement and 10.5% absolute increase (P = .077). There was a trend for prolonged progression-free survival (PFS; median 241 days for CAF v 366 days for dofequidar + CAF; P = .145). In retrospectively defined subgroups, significant improvement in PFS in favor of dofequidar was observed in patients who were premenopausal, had no prior therapy, and were stage IV at diagnosis with an intact primary tumor. Except for neutropenia and leukopenia, there was no statistically significant excess of grade 3/4 adverse events compared with CAF. Treatment with dofequidar did not affect the plasma concentration of doxorubicin. CONCLUSION: Dofequidar + CAF was well tolerated and is suggested to have efficacy in patients who had not received prior therapy.

Adult↗

PubMed2006

Prospective study of positron emission tomography for evaluation of the activity of lapatinib, a dual inhibitor of the ErbB1 and ErbB2 tyrosine kinases, in patients with advanced tumors.

BACKGROUND: To evaluate the role of FDG-PET in assessing anti-tumor efficacy of molecular targeted drugs, we prospectively performed FDG-PET and CT for response evaluation in patients treated with lapatinib, a dual inhibitor of ErbB1 and ErbB2 tyrosine kinases. METHODS: Lapatinib was given orally once a day at doses ranging from 1200 to 1800 mg in a phase I study. CT and FDG-PET were performed before treatment, and at 1, 2 and 3 months after the initiation of the treatment and every 2 months thereafter. RESULTS: A total of 29 FDG-PET examinations were performed in eight patients with various solid tumors and the metabolic activity in the tumor was evaluated as SUVmax. The best responses, as assessed by CT, were as follows; one partial response, four stable disease and three disease progression. The partial response was observed in a patient with trastuzumab-resistant breast cancer, whose SUVmax was decreased by 60% from baseline. In all of the four patients whose best response was stable disease, the SUVmax was decreased by 6-42% one month after the start of treatment. Prolonged stable disease (10 months) was observed in a patient with colon cancer, whose SUVmax was decreased by 42%. In the patient group with disease progression, SUVmax was increased in two out of three patients. CONCLUSIONS: FDG-PET detected decreases in the metabolic activity of the tumors in patients who experienced clinical benefits on treatment with lapatinib. Thus, FDG-PET may be useful for the evaluation of molecular targeted drugs, such as lapatinib.

Adult↗

PubMed2006

Once-weekly epoetin-beta improves hemoglobin levels in cancer patients with chemotherapy-induced anemia: A randomized, double-blind, dose-finding study.

OBJECTIVE: To determine a recommended dose of once-weekly epoetin-beta administration for anemic cancer patients receiving myelosuppressive chemotherapy, we conducted a multicenter, randomized, double-blind trial. METHODS: A total of 86 patients with malignant lymphoma or lung cancer who received chemotherapy containing platinum, taxanes or anthracyclines were enrolled in the study. Patients were randomly assigned into groups that received three dose levels of epoetin-beta (9000, 18,000 or 36,000 IU) administered subcutaneously once a week for 12 weeks. The primary endpoint was change in hemoglobin, while the secondary endpoints were quality of life (QOL) assessed by Functional Assessment of Cancer Therapy-Anemia (FACT-An) questionnaire and transfusion requirements. RESULTS: Among the 69 patients (per protocol set population) assessable for efficacy, hemoglobin level change in the 36,000 IU group was significantly greater than that in the 9000 IU group (1.75 +/- 2.15 versus 0.04 +/- 1.98 g/dl; P = 0.009), and a significant dose-response relationship was observed for the change in hemoglobin level (P = 0.003). Although changes in FACT-An Total Fatigue subscale (Fatigue subscale) scores were similar for the three dosage groups, there was a statistically significant correlation (r = 0.435, P < 0.001) between the change in hemoglobin levels and the change in Fatigue subscale scores. The proportion of transfused patients was significantly smaller in the 36 000 IU group compared with that in the 9000 IU group (P = 0.022, not adjusted for pre-study transfusions). The incidence of adverse events was similar in the three dosage groups. CONCLUSIONS: Once-weekly epoetin-beta 36,000 IU for 12 weeks was well tolerated and significantly increased hemoglobin levels in anemic cancer patients receiving chemotherapy.

Adult↗

PubMed2006

Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer.

OBJECTIVE: Paclitaxel is one of the most important anticancer drugs for the treatment of various tumors such as non-small cell lung cancer. We investigated the association between CYP3A4 haplotypes and pharmacokinetic parameters of paclitaxel metabolism. METHODS: This study enrolled 235 Japanese patients with cancer who were receiving paclitaxel. These patients were screened for CYP3A4 gene polymorphisms by either direct sequencing or pyrosequencing. Plasma concentrations of paclitaxel and its 3 metabolites were determined by HPLC in 229 patients. RESULTS: Median values of paclitaxel clearance, normalized for body surface area, were lower in the high-dose group (>or=175 mg/m2, n = 199) than in the low-dose group (<or=100 mg/m2, n = 30), suggesting nonlinearity of pharmacokinetics caused by Cremophor EL. Therefore we mainly used the patients in the high-dose group for further analysis. The median value of the area under the curve (AUC) ratio of 3'-p-hydroxypaclitaxel to paclitaxel was 20% greater (95% confidence interval, 2.4% to 41.7%) in the women than in the men (P = .01). Although no significant difference in paclitaxel clearance was observed among the CYP3A4 haplotypes, 16B-bearing (1/16B) patients (n = 8) showed a 20% lower (95% confidence interval, -58.5 to -11.5%) median AUC ratio of 3'-p-hydroxypaclitaxel to paclitaxel (P = .04) and a 2.4-fold higher median AUC ratio of 6alpha-hydroxypaclitaxel to paclitaxel (P < .001) compaed with those in the wild-type (1/1) patients (n = 180). In contrast, no significant differences were seen between 1/1 and 18B/1 (n = 10) patients for the pharmacokinetic parameters examined. CONCLUSIONS: Our results suggest that CYP3A416B is associated with both reduced 3'-p-hydroxylation of paclitaxel and probably increased levels of 6alpha-hydroxypaclitaxel.

Adult↗

PubMed2006

Inhibition of bone-derived insulin-like growth factors by a ligand-specific antibody suppresses the growth of human multiple myeloma in the human adult bone explanted in NOD/SCID mouse.

Multiple myeloma (MM) is a fatal disease that affects plasma cells. Patients with MM have 1 or more osteolytic lesions in their bone tissues, where insulin-like growth factors (IGFs; IGF-I and IGF-II) are mainly stored. The role of bone-derived IGFs in the development of MM has not been extensively studied because reliable animal models are lacking. We established an animal model using a human MM cell line, RPMI8226, in nonobese diabetic/severe-combined immunodeficient (NOD/SCID) mice implanted with human adult bone (HAB) fragments. Treatment with an anti-human IGF-neutralizing monoclonal antibody, KM1468, inhibited the IGF-I-stimulated phosphorylation of type-I IGF receptors (IGF-IR) in RPMI8226 cells and the activation of the downstream PI3-K/Akt signaling pathway in vitro. KM1468 inhibited IGF-I-mediated RPMI8226 cell growth in a dose-dependent manner. In the NOD/SCID-HAB model, treatment with KM1468 significantly inhibited the growth of RPMI8226 cells (p<0.02). These results indicated that the growth of MM cells was predominantly stimulated not by serum-derived IGFs, but by bone-derived IGFs. Furthermore, the targeting of bone-derived IGFs, using a neutralizing antibody, may offer a new therapeutic strategy for MM.

Animals↗

PubMed2006

Pharmacokinetics and pharmacodynamics of protein-unbound docetaxel in cancer patients.

Alpha(1)-acid glycoprotein, a plasma protein that binds docetaxel, is a significant determinant of the clearance and activity of docetaxel, but its serum levels in cancer patients are variable. This emphasizes the importance of investigating the pharmacokinetics of unbound drug rather than total drug in the plasma. In the present study, the pharmacokinetics and pharmacodynamics of unbound docetaxel were investigated in cancer patients. Docetaxel was infused over a 1-h period in 69 patients. The concentration of unbound docetaxel was measured in the plasma ultrafiltrate at the end of infusion and the unbound fraction (fu) was calculated. The pharmacokinetics of total docetaxel in the plasma was investigated. The area under the concentration-time curve (AUC) of unbound docetaxel was calculated by multiplying fu by the AUC of total docetaxel. The peak concentration at the end of infusion (Cmax) and AUC of total and unbound drug were compared between patients who did or did not experience grade 4 neutropenia. The median of fu was 4.0%, ranging from 1.2 to 22.6% (5-95% percentile; 1.4-10.5%). Grade 4 neutropenia was observed in 24 patients. Although Cmax and AUC of total drug were not different in patients with or without grade 4 neutropenia, patients who experienced grade 4 neutropenia had significantly greater Cmax (92.3 vs 63.3 ng/mL, P=0.01) and AUC (0.137 vs 0.104 microgxh/mL, P=0.05) of unbound docetaxel. In a logistic regression analysis, the unbound Cmax and alpha1-acid glycoprotein were determinants of grade 4 neutropenia. Pharmacokinetics of unbound drug rather than total drug is a better predictor of neutropenia for docetaxel.

Adult↗

PubMed2006

Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

ATP Binding Cassette Transporter, Subfamily G, Mem↗

PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

PubMed2005

Phase II study of oral fludarabine phosphate in relapsed indolent B-Cell non-Hodgkin's lymphoma.

PURPOSE: Although intravenous (IV) fludarabine phosphate is effective against indolent B-cell non-Hodgkin's lymphoma (B-NHL), IV administration for 3 to 5 consecutive days is inconvenient in an outpatient setting. To assess the efficacy and toxicity of oral fludarabine phosphate in patients with indolent B-NHL, we conducted a multicenter phase II study. PATIENTS AND METHODS: Patients with relapsed indolent B-NHL received fludarabine phosphate tablets orally once daily on days 1 through 5 every 28 days for three to six cycles. The efficacy was separately analyzed in a mantle-cell lymphoma (MCL) cohort and indolent B-NHL except for MCL (IL) cohort. The primary end point was the overall response rate (ORR). RESULTS: Fifty-two patients, including 46 in the IL cohort (41 with follicular lymphoma) and six in the MCL cohort, were registered, and all patients were eligible. Forty-one patients (79%) had received rituximab as prior therapy. In the IL cohort, the ORR and complete response rate were 65% (30 of 46 patients; 95% CI, 50% to 79%) and 30% (14 of 46 patients; 95% CI, 18% to 46%), respectively. One of six patients with MCL achieved a partial response. The median times to treatment failure for the 46 patients in the IL cohort and for the six patients in the MCL cohort were 8.6 and 6.1 months, respectively. Hematologic toxicities, including grade 4 neutropenia (37%), were the most frequent toxicities, and nonhematologic toxicities were mild. CONCLUSION: Oral fludarabine phosphate is highly effective in patients with relapsed indolent B-NHL who have mostly been pretreated with rituximab and is more convenient than the IV formulation.

Administration, Oral↗

PubMed2005

Functional characterization of three naturally occurring single nucleotide polymorphisms in the CES2 gene encoding carboxylesterase 2 (HCE-2).

Twelve single nucleotide polymorphisms (SNPs) in the human CES2 gene, which encodes a carboxylesterase, hCE-2 [human carboxylesterase 2 (EC 3.1.1.1)], have been reported in the Japanese. In this report, we have examined functional alterations of three SNPs, a nonsynonymous SNP (100C>T, R34W), an SNP at the splice acceptor site in intron 8 (IVS8-2A>G), and one newly discovered nonsynonymous SNP (424G>A, V142M). For the two nonsynonymous SNPs, the corresponding variant cDNAs were expressed in COS-1 cells. Both the R34W and V142M variants showed little esterase activities toward the anticancer agent irinotecan and two typical carboxylesterase substrates, p-nitrophenol acetate and 4-methylumbelliferyl acetate, although increased levels of cDNA-mediated protein expression were observed by Western blotting as compared with the wild type. To investigate a possible splicing aberration in IVS8-2A>G, an in vitro splicing assay was utilized and transcripts derived from CES2 gene fragments of the wild type and IVS8-2A>G were compared. Sequence analysis of the cloned transcripts revealed that IVS8-2A>G yielded mostly aberrantly spliced transcripts, including a deleted exon or a 32-bp deletion proximal to the 5' end of exon 9, which resulted in truncated hCE-2 proteins. These results suggested that 100C>T (R34W), 424G>A (V142M), and IVS8-2A>G are functionally deficient SNPs.

Animals↗

PubMed2005

Functional analysis of four naturally occurring variants of human constitutive androstane receptor.

The human constitutive androstane receptor (CAR, NR1I3) is a member of the orphan nuclear receptor superfamily that plays an important role in the control of drug metabolism and disposition. In this study, we sequenced all the coding exons of the NR1I3 gene for 334 Japanese subjects. We identified three novel single nucleotide polymorphisms (SNPs) that induce non-synonymous alterations of amino acids (His246Arg, Leu308Pro, and Asn323Ser) residing in the ligand-binding domain of CAR, in addition to the Val133Gly variant, which was another CAR variant identified in our previous study. We performed functional analysis of these four naturally occurring CAR variants in COS-7 cells using a CYP3A4 promoter/enhancer reporter gene that includes the CAR responsive elements. The His246Arg variant caused marked reductions in both transactivation of the reporter gene and in the response to 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime (CITCO), which is a human CAR-specific agonist. The transactivation ability of the Leu308Pro variant was also significantly decreased, but its responsiveness to CITCO was not abrogated. The transactivation ability and CITCO response of the Val133Gly and Asn323Ser variants did not change as compared to the wild-type CAR. These data suggest that the His246Arg and Leu308Pro variants, especially His246Arg, may influence the expression of drug-metabolizing enzymes and transporters that are transactivated by CAR.

Animals↗

PubMed2005

Functional analysis of six human aryl hydrocarbon receptor variants in a Japanese population.

Aryl hydrocarbon receptor (AhR) is an important transcriptional regulator involved in the induction of CYP1A1, CYP1A2, CYP1B1, UGT1A1, and UGT1A6. In this study, functional properties of four novel naturally occurring human AhR variants (K401R, N487D, I514T, and K17T/R554K) were examined along with the single variants K17T and R554K. The luciferase reporter assay using the CYP1A1 promoter reporter in HeLa cells treated with beta-naphthoflavone or 3-methylcholanthrene, which are known as typical agonists for AhR, showed that reporter activities of the K401R and N487D variants were reduced to 40 to 58% of those of wild-type (WT) but not of the other variants. Similarly, the K401R and N487D variants also reduced the omeprazole-induced reporter activities to approximately 56 and 74% of those of the WT, respectively. The reduced activities of the two variants were probably caused by the reduced protein expression levels, since the protein levels of the K401R and N487D variants were approximately 52 and 47% of the WT, respectively, without any changes in their mRNA levels. The reduced protein levels were recovered by treatment with a proteasome inhibitor MG132 [N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal], suggesting that the reduced protein levels were caused by the accelerated proteasomal degradation by a proteasome. Together, the current data demonstrate that the K401R and N487D variants reduce their apparent transcriptional activities, both ligand-induced and omeprazole-induced activation, probably through reduced protein expression. Thus, these two variants may influence drug metabolism through reduced induction of CYP1A1 and other target enzymes.

Genes, Reporter↗

PubMed2005

Pharmacokinetic and pharmacodynamic comparison of fluoropyrimidine derivatives, capecitabine and 5'-deoxy-5-fluorouridine (5'-DFUR).

PURPOSE: Capecitabine is a three-step prodrug that was rationally designed to be a more effective and safer alternative to its intermediate metabolite, 5'-deoxy-5-fluorouridine (5'-DFUR). We compared the pharmacokinetics/pharmacodynamics of these drugs in metastatic breast cancer patients. METHODS: Six patients received oral capecitabine at 1657 mg/m2 twice daily and 17 received 5'-DFUR at 400 mg three times daily. Both drugs were administered for 21 days followed by a 7-day rest. RESULTS: Median daily 5'-DFUR AUC was significantly higher for capecitabine than for 5'-DFUR (81.1 vs 32.6 mmol h/l; P = 0.01). Following treatment with 5'-DFUR, the median AUC and Cmax of 5'-DFUR tended to be higher in patients with a partial response (3.83 microg h/ml and 4.88 microg/ml) and stable disease (6.46 microg h/ml and 4.96 microg/ml) than in those with disease progression (2.53 microg h/ml and 1.36 microg/ml). The AUC and Cmax of 5'-DFUR was significantly related to overall survival. CONCLUSIONS: These results support the superiority of capecitabine over 5'-DFUR.

Administration, Oral↗

PubMed2005

Sequence effect of docetaxel and carboplatin on toxicity, tumor response and pharmacokinetics in non-small-cell lung cancer patients: a phase I study of two sequences.

PURPOSE: To investigate sequence effects on toxicity, tumor response and pharmacokinetics of docetaxel and carboplatin, together with a determination of the maximum-tolerated dose (MTD) and recommended dose for each schedule. PATIENTS AND METHODS: A total of 46 chemotherapy-naive patients with advanced non-small-cell lung cancer were randomized to receive docetaxel before (schedule A) or after (schedule B) carboplatin. The dose levels studied were [docetaxel (mg/m(2))/carboplatin (mg x min/ml)] 50/5, 60/5, 60/6, 60/7, and 70/6. Treatment cycles were repeated every 3 or 4 weeks unless disease progression or undue toxicity occurred. RESULTS: Of the 46 patients, 44 were assessable for toxicity and received a total of 84 cycles. The major dose-limiting toxicity was neutropenia. When the docetaxel dose was 60 mg/m(2), the carboplatin MTD was deemed to be AUC 7 in both schedules. When the docetaxel dose was escalated to 70 mg/m(2), the carboplatin MTD was reached in schedule A, and the dose-limiting toxicity was not observed in schedule B. Tumor response was observed in 4 of 22 patients (18%) with schedule A and 8 of 19 (42%) with schedule B. Clearances of both drugs were not affected by sequence: 111.2+/-26.8 ml/min and 107.8+/-29.0 ml/min for carboplatin (P=0.69), and 26.7+/-8.3 l/h and 22.8+/-7.0 l/h for docetaxel (P=0.19) in schedules A and B, respectively. CONCLUSIONS: Carboplatin AUC 6 followed by docetaxel 70 mg/m(2) was a favorable regimen for phase II study because of likely lower toxicity and a potentially higher response rate than the reverse sequence schedule. The mechanism of the sequence effects on toxicity and tumor response could not be explained by the pharmacokinetic interactions.

Adult↗

PubMed2005

Zoledronic acid significantly reduces skeletal complications compared with placebo in Japanese women with bone metastases from breast cancer: a randomized, placebo-controlled trial.

PURPOSE: To investigate the efficacy and safety of zoledronic acid for the treatment of bone metastases from breast cancer. PATIENTS AND METHODS: Women with bone metastases (N = 228) were randomly assigned to receive 4 mg zoledronic acid (n = 114) or placebo (n = 114) via 15-minute infusions every 4 weeks for 1 year. The primary efficacy end point was the skeletal-related event (SRE) rate ratio between treatment groups. An SRE was defined as pathologic fracture, spinal cord compression, and radiation or surgery to bone. Secondary end points included percentage of patients with at least one SRE, time-to-first SRE, and Andersen-Gill multiple-event analysis. RESULTS: The SRE rate ratio at 1 year (excluding HCM and adjusted for prior fracture) was 0.61 (permutation test; P = .027), indicating that zoledronic acid reduced the rate of SRE by 39% compared with placebo. The percentage of patients with at least one SRE (excluding HCM) was significantly reduced by 20% by zoledronic acid (29.8% v 49.6% for placebo; P = .003). Zoledronic acid significantly delayed time-to-first SRE (median not reached v 364 days; Cox regression; P = .007) and reduced the risk of SREs by 41% in multiple event analysis (risk ratio = 0.59; P = .019) compared with placebo. Zoledronic acid was well tolerated with a safety profile similar to placebo. No patient treated with zoledronic acid had grade 3 or 4 serum creatinine increase. CONCLUSION: Zoledronic acid significantly reduced skeletal complications compared with placebo across multiple end points in Japanese women with bone metastases from breast cancer.

Adult↗

PubMed2005

Functional characterization of five novel CYP2C8 variants, G171S, R186X, R186G, K247R, and K383N, found in a Japanese population.

Cytochrome P450 2C8 is one of the primary enzymes responsible for the metabolism of a wide range of drugs such as paclitaxel, cerivastatin, and amiodarone. We have sequenced the CYP2C8 gene from 201 Japanese subjects and found five novel nonsynonymous single nucleotide polymorphisms (SNPs): 511G>A (G171S), 556C>T (R186X; X represents the translational stop codon), 556C>G (R186G), 740A>G (K247R), and 1149G>T (K383N), with the allele frequency of 0.0025. The CYP2C8 variants were heterologously expressed in COS-1 cells and functionally characterized in terms of expression level, paclitaxel 6alpha-hydroxylase activity, and intracellular localization. The prematurely terminated R186X variant was undetectable by Western blotting and inactive toward paclitaxel 6alpha-hydroxylation. The G171S, K247R, and K383N variants exhibited properties similar to those of the wild-type CYP2C8. Paclitaxel 6alpha-hydroxylase activity of the R186G transfectant was only 10 to 20% that of wild-type CYP2C8. Furthermore, the R186G variant displayed a lower level of protein expression in comparison to the wild type, which was restored by the addition of a proteasome inhibitor (MG-132; Z-Leu-Leu-Leu-aldehyde). The reduced CO-difference spectral analysis using recombinant proteins from an insect cell/baculovirus system revealed that the R186G variant has a minor peak at 420 nm in addition to the characteristic Soret peak at 450 nm, suggesting the existence of improperly folded protein. These results indicate that the novel CYP2C8 SNPs, 556C>T (R186X) and 556C>G (R186G), could influence the metabolism of CYP2C8 substrates such as paclitaxel and cerivastatin.

Animals↗

PubMed2005

A multicenter and open label clinical trial of zoledronic acid 4 mg in patients with hypercalcemia of malignancy.

BACKGROUND: Hypercalcemia of malignancy is a serious complication of cancer. The objective of this study was to investigate the efficacy and safety of zoledronic acid, a new-generation bisphosphonate and the most potent inhibitor of bone resorption identified to date, for hypercalcemia of malignancy in Japanese patients. METHODS: Patients with hypercalcemia of malignancy, defined as an albumin-corrected serum calcium level > or =12.0 mg/dl, were treated with a single dose of zoledronic acid, 4 mg, by 15 min infusion. Clinical end-points included the proportion of patients with complete response, which was defined as a decrease of corrected serum calcium < or =10.8 mg/dl by day 10, and time to relapse, which is defined as the duration in days between the date of infusion and last available corrected serum calcium <11.6 mg/dl. RESULTS: Twenty-seven patients were enrolled in this study and 25 patients were evaluable for the efficacy of zoledronic acid. The mean corrected serum calcium level decreased from 14.5 to 9.6 mg/dl by day 10. The complete response rate was 84%. The median time to relapse was 23 days, ranging from 0 to 56 days. The most frequently observed adverse event was fever (< or =38 degrees C). Electrolyte abnormalities suspected to be drug related including grade 3 or 4 hypocalcemia, hypophosphatemia and hypokalemia were observed in 11 patients; however, all patients were asymptomatic. No serious adverse events associated with renal toxicity were reported. CONCLUSIONS: Zoledronic acid is well tolerated and is effective for hypercalcemia of malignancy in Japanese patients.

Adult↗