PubMed Health⌕ Search

Biomedical subjects

I Cielens

Publications and source records attributed to I Cielens.

7 recordsLinked to original sources
PubMed2000

Mutilation of RNA phage Qbeta virus-like particles: from icosahedrons to rods.

Icosahedral virus-like particles (VLPs) of RNA phage Qbeta are stabilized by four disulfide bonds of cysteine residues 74 and 80 within the loop between beta-strands F and G (FG loop) of the monomeric subunits, which determine the five-fold and quasi-six-fold symmetry contacts of the VLPs. In order to reduce the stability of Qbeta VLPs, we mutationally converted the amino acid stretch 76-ANGSCD-81 within the FG loop into the 76-VGGVEL-81 sequence. It led to production in Escherichia coli cells of aberrant rod-like Qbeta VLPs, along with normal icosahedral capsids. The length of the rod-like particles exceeded 4-30 times the diameter of icosahedral Qbeta VLPs.

Allolevivirus↗
PubMed1998

Mosaic Qbeta coats as a new presentation model.

The new protein carrier was developed on the basis of recombinant RNA phage Qbeta capsid. C-terminal UGA extension of the short form of Qbeta coat, so-called A1 extension, served as a target for presentation of foreign peptides on the outer surface of mosaic Qbeta particles. In conditions of enhanced UGA suppression, the proportion of A1-extended to short coats in mosaic particles dropped from 48% to 14%, with an increase of the length of A1 extension. A model insertion, short preS1 epitope 31-DPAFR-35 of hepatitis B surface antigen, demonstrated superficial location on the mosaic Qbeta particles and ensured specific antigenicity and immunogenicity.

Allolevivirus↗
PubMed1996

RNA phage Q beta coat protein as a carrier for foreign epitopes.

The Q beta gene C has been proposed as a new carrier for the exposure of foreign peptide sequences. Contrary to well-known 'display vectors' on the basis of coat proteins of RNA phage group I, group III phage Q beta-based vectors suggested application of the 195-amino acid extension of coat protein (CP) within the so-called A1 protein for insertion of the appropriate immunological epitopes. 'Mosaic' capsids presenting model hepatitis B virus preS1 and HIV-1 gp120 epitopes and formed by Q beta CP together with A1-derived proteins were obtained as a result of (1) suppression of leaky UGA stop codon of the CP gene and (2) simultaneous expression of 'pure' CP and full-length A1-derived genes obtained after the changing of CP-terminating UGA to strong UAA stop codon or sense GGA codon, respectively.

Amino Acid Sequence↗
PubMed1993

Recombinant RNA phage Q beta capsid particles synthesized and self-assembled in Escherichia coli.

The Escherichia coli RNA phage Q beta coat protein-encoding gene (C) was amplified from native Q beta RNA using a reverse transcription-PCR technique. Gene C contains sequences coding for both the 133-amino acid (aa) Q beta coat protein (CP) and the 329-aa read-through protein (A1) consisting of CP and an additional 196-aa C-terminal sequence, separated from CP within the C gene by an opal (UGA) stop codon. Primers ensuring the natural environment for gene C, especially within the ribosome-binding site, and supplying C with unique restriction sites at both ends have been prepared. An amplified 1062-bp PCR fragment was positioned under the control of the strong E. coli trp promoter (Ptrp) within a pGEM-derived plasmid. The synthesis of gene C products was confirmed electrophoretically and immunologically. An immunodiffusion test with anti-Q beta phage antibodies and electron microscopy evaluation of the purified recombinant products showed that when expressed, the Q beta C gene was responsible for high-level synthesis and correct self-assembly of Q beta CP monomers into capsids indistinguishable morphologically and immunologically from Q beta phage particles, which we plan to use as surface display vectors.

Allolevivirus↗
PubMed1985

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr.

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.

Base Sequence↗
PubMed1982

The regulatory region of phage fr replicase cistron. III. Initiation activity of specific fr RNA fragments.

RNA fragments from phage fr covering the complete or part of the replicase cistron initiation region have been used as templates in the formation of a ribosomal initiation complex in vitro. The results so obtained together with our earlier findings in a similar approach applied to fragments of the structurally related RNA from phage MS2 have allowed us to pinpoint the boundaries of the replicase cistron initiation region on phage RNA. A structural model of the above initiation region has been provided which shows that besides the minimal initiation region (comprises the Shine-Dalgarno sequence and initiator AUG), the flanking regions are also involved and are responsible for additional interactions with the ribosome. The flanking regions possibly contribute to the stability of specific contact between the ribosome and template realized by the minimal initiation region.

Base Sequence↗