PubMed Health⌕ Search

Biomedical subjects

Irina M Russu

Publications and source records attributed to Irina M Russu.

11 recordsLinked to original sources
PubMed2006

Structural energetics and base-pair opening dynamics in sarcin-ricin domain RNA.

The sarcin-ricin domain is a universal element of the RNA from the large ribosomal subunit. The domain is part of the binding site for elongation factors and is specifically cleaved by the toxins alpha-sarcin and ricin. In this work, we have mapped the energetics and dynamics of individual structural motifs in a 29-mer RNA oligomer containing the sarcin-ricin domain. The stability of individual base pairs in the structure was characterized from measurements of the exchange rates of imino protons using nuclear magnetic resonance spectroscopy at 10 degrees C. The measurements also provided the rates of opening and closing for selected base pairs. The results reveal that the structural stabilization free energies in the sarcin-ricin domain are broadly distributed between 2.9 and 10.6 kcal/mol. One of the least stable sites in the structure is the noncanonical G-A base pair located next to the phosphodiester bond that is cleaved by alpha-sarcin. The low stability of this base pair supports the proposal that cleavage by alpha-sarcin occurs by a base flipping mechanism. The opening dynamics of other base pairs is affected by elements of the structure such as the bulged-G motif and its cross-strand stacking. Participation in these motifs increases the lifetimes of the bases in an open, solvent-accessible conformation.

Animals↗
PubMed2006

Specific interactions of divalent metal ions with a DNA duplex containing the d(CA)n/(GT)n tandem repeat.

Divalent metal ions are essential for maintaining functional states of the DNA molecule. Their participation in DNA structure is modulated by the base sequence and varies depending on the nature of the ion. The present investigation addresses the interaction of Ca2+ ions with a tandem repeat of two CA dinucleotides, (CA)2/(TG)2. The binding of Ca2+ to the repeat is monitored by nuclear magnetic resonance (NMR) spectroscopy using chemical shift mapping. Parallel experiments monitor binding of Mg2+ ions to the repeat as well as binding of each ion to a DNA duplex in which the (CA)2/(TG)2 repeat is eliminated. The results reveal that the direction and the magnitude of chemical shift changes induced by Ca2+ ions in the NMR spectra of the repeat are different from those induced by Mg2+ ions. The differences between the two cations are significantly diminished by the elimination of the (CA)2/(TG)2 repeat. These findings suggest a specific interaction of Ca2+ ions with the (CA)2/(TG)2 motif. The specificity of the interaction resides in the two A-T base pairs of the repeat, and it involves the major groove of the first A-T base pair and both grooves of the second A-T base pair.

Calcium↗
PubMed2005

A nuclear magnetic resonance investigation of the energetics of basepair opening pathways in DNA.

The opening of basepairs plays a key role in DNA replication and transcription, and in the action of DNA repair and modification enzymes. In this article, we have used proton exchange to define the energetics of the pathways for basepair opening in two DNA 17-mer duplexes. The rates of exchange of imino protons with solvent protons were measured by NMR spectroscopy for each DNA duplex, as a function of the concentration of exchange catalyst and of temperature. The measurements provided the rates and the equilibrium constants of the opening reactions for individual basepairs at different temperatures. These temperature dependences were used to calculate the enthalpies and the free energies of the barrier to opening and of the open state for each basepair. The results reveal the existence of three distinct patterns of enthalpy changes in the opening reactions. The patterns differ from each other in the location of the kinetic opening barrier relative to the open state. Neighboring bases, which are one or more positions removed from the opening basepair, influence the enthalpic pattern of the opening pathway. The free energies of the opening barriers are found to be linearly related to the free energies of the open state. This correlation is analyzed in terms of rate-equilibrium free energy relationships previously observed in other systems, and suggests that the transition state in the opening reaction is closer to the native closed state of the basepair than to its open state.

Ammonia↗
PubMed2005

Base pair opening in three DNA-unwinding elements.

DNA-unwinding elements are specific base sequences that are located in the origin of DNA replication where they provide the start point for strand separation and unwinding of the DNA double helix. In the present work we have obtained the first characterization of the opening of individual base pairs in DNA-unwinding elements. The three DNA molecules investigated reproduce the 13-mer DNA-unwinding elements present in the Escherichia coli chromosome. The base sequences of the three 13-mers are conserved in the origins of replication of enteric bacterial chromosomes. The exchange of imino protons with solvent protons was measured for each DNA as a function of the concentration of exchange catalyst using nuclear magnetic resonance spectroscopy. The exchange rates provided the rates and the equilibrium constants for opening of individual base pairs in each DNA at 20 degrees C. The results reveal that the kinetics and energetics of the opening reactions for AT/TA base pairs are different in the three DNA-unwinding elements due to long range effects of the base sequence. These differences encompass the AT/TA base pairs that are conserved in various bacterial genomes. Furthermore, a qualitative correlation is observed between the kinetics and energetics of opening of AT/TA base pairs and the location of the corresponding DNA-unwinding element in the origin of DNA replication.

Ammonia↗
PubMed2004

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Base Pairing↗
PubMed2004

Sequence-dependence of the energetics of opening of at basepairs in DNA.

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the energetics of opening of AT/TA basepairs in the DNA dodecamer 5'-d(GCTATAAAAGGG)-3'/5'-d(CCCTTTTATAGC)-3'. The dodecamer contains the TATA box of the adenovirus major late promoter. The equilibrium constants for opening of each basepair are measured from the dependence of the exchange rates of imino protons on ammonia concentration. The enthalpy, entropy, and free energy changes in the opening reaction of each basepair are determined from the temperature dependence of the exchange rates. The results reveal that the opening enthalpy changes encompass a wide range of values, namely, from 17 to 29 kcal/mol. The largest values are observed for the AT basepairs in 7th and 8th positions. These values, and the exchange rates of the corresponding imino protons, suggest that these two basepairs open in a single concerted reaction. The enthalpy changes for opening of the central six basepairs are correlated to the opening entropy changes. This enthalpy-entropy compensation minimizes the variations in the opening free energies among these central basepairs. Deviations from the enthalpy-entropy compensation pattern are observed for basepairs located close to the ends of the duplex structure, suggesting a different mode of opening for these basepairs.

AT Rich Sequence↗
PubMed2003

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors.

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.

DNA↗
PubMed2002

Allosteric effects of chloride ions at the intradimeric alpha1beta1 and alpha2beta2 interfaces of human hemoglobin.

The structural transition induced by ligand binding in human hemoglobin encompasses quaternary structure changes at the interfaces between the two alphabeta dimers. In contrast, the interfaces between alpha and beta subunits within the same dimer (i.e., alpha1beta1 and alpha2beta2 interfaces) are structurally invariant. Previous work from this laboratory using NMR spectroscopy has identified four sites at the intradimeric alpha1beta1 and alpha2beta2 interfaces that, although structurally invariant, experience significant changes in the rates of proton exchange upon ligand binding. These sites are Hisalpha103(G10) and Hisalpha122(H5) in each alpha subunit of the hemoglobin tetramer. In the present work, we show that the proton exchange at the Hisalpha103(G10) sites is affected by the interactions of hemoglobin with chloride ions. Increasing concentrations of chloride ions at pH 6.45 and at 37 degrees C enhance the exchange rate of the Hisalpha103(G10) N(epsilon 2) proton. The enhancement is greater in deoxygenated than in ligated hemoglobin. In the framework of the local unfolding model for proton exchange, these results suggest that the structural free energy and/or the proton transfer reactions at the Hisalpha103(G10) sites depend on the concentration of chloride ions. Therefore, the ligand-induced changes at the Hisalpha103(G10) sites are modulated by the allosteric effect of chloride ions on hemoglobin.

Allosteric Regulation↗
PubMed2002

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.

Base Pairing↗
PubMed2002

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy.

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.

Adenine↗