[Cancer of the prostate with metastasis to the penis].
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to J Andersen.
Explore the source record for details and available documents.
The nucleotide sequence of the cytoplasmic 5 S ribosomal RNA from Spinacia oleracea has been determined. A secondary structural model possessing four base-paired regions can be constructed from the primary structure. This RNA shows 90 to 93% nucleotide sequence homology with other higher plant cytoplasmic 5 S RNAs and 73% homology with that of the lower eukaryote Chlorella. The spinach 5 S RNA has the nucleotide sequence identical with that of Chlorella in two important single-stranded regions, the sequence C10 AUACC and the dodecanucleotide sequence at positions 33 to 44. A nucleotide sequence similar or identical with C10 AUACC is found in most other eukaryotic 5 S RNAs, including the 5 S RNA from human KB cells. In addition, a single-stranded loop of 12 residues corresponding to positions 33 to 44 in the spinach 5 S RNA sequence may be a general feature of eukaryotic cytoplasmic 5 S RNAs, while prokaryotic 5 S RNAs have a 13-member loop for the corresponding residues. Several other important homologies in primary and secondary structure have also been observed in comparing spinach 5 S RNA to other 5 S RNAs.
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Nineteen patients with L-DOPA treated parkinsonism involving depressive symptoms, the therapeutic effect of nortriptyline was compared to placebo in a controlled trial. The depressive and neurological symptoms were evaluated by rating scales. Nortriptyline had a clinical significant effect with regard to the depressive symptoms, whereas the neurological parameters were unchanged. The authors suggest the depression in Parkinson's disease to be of both reactive and endogenous origins.
The study comprises a retrospective evaluation of case records of 220 patients admitted for the first time with psychogenic psychosis with special reference to clinical course and prognosis within a period of 13--14 years. The reliability of the diagnosis at the time of the first admission is about 60% when the evaluation is based on positive criteria for psychosis. If the psychogenic psychoses are divided into subgroups, the reliability of the diagnosis of psychogenic affective psychoses is about 30%, whereas it is over 90% for psychogenic confusional psychoses and psychogenic paranoid psychoses. If subsequent cases of other functional psychoses (manic-depressive psychosis and schizophrenia) are subtracted, the diagnostic reliability is 50% (111 of 220 cases), which represents the number of retrospectively verified psychogenic psychoses. The frequency of recurrence of psychogenic psychosis was 18% (40), corresponding to 36% of psychogenic psychoses verified by retrospective evaluation (111 of 220 cases). The recurrences were mainly homologous, as heterologous recurrences developed only among the psychogenic affective psychoses (slightly less than half of the recurrences in question). Schizophrenia developed in only 10% (23), and subsequent episodes of manic-depressive psychosis occurred in 8% (18). The stability of psychogenic psychosis on recurrence of functional psychosis was 49% expressed in relation to all subsequent cases of functional psychosis. The over-all prognosis for the psychogenic/reactive psychosis is thus good as regards subsequent mental disease. Chronic functional psychosis (schizophrenia) developed in only 10% (and in less than 20% if the prognosis is assessed on the basis of the reliability of the diagnosis at the time of the first admission (about 60%)). However, in the group of psychogenic/reactive psychoses as a whole an overmortality of 100% was observed in the course of the 14 years, highest in the younger age groups.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
A method for identifying lymph nodes in tissue specimens from patients with carcinoma of the colon and rectum by soft X-rays is described and assessed. The method seems superior to more time-consuming and possibly tissue-damaging procedures, and it affords a possibility of identifying lymph nodes down to a size 1--2 mm in formalin-fixed as well as in non-fixed tissue specimens.
Explore the source record for details and available documents.