PubMed Health⌕ Search

Biomedical subjects

J Barbé

Publications and source records attributed to J Barbé.

At least 37 records · Page 2Linked to original sources
PubMed1997

Cloning and characterization of the recA of Paracoccus denitrificans and construction of a recA-deficient mutant.

The recA gene of Paracoccus denitrificans has been isolated from a genomic library by hybridization with the Rhodobacter sphaeroides recA gene. Its complete nucleotide sequence consists of 1071 bp encoding a polypeptide of 356 amino acids. Nucleotide sequence analysis of the P. denitrificans recA gene revealed the closest identities with the R. sphaeroides and the Rhodobacter capsulatus recA genes. Nevertheless, and surprisingly, recA genes of these two phototrophic bacteria are not DNA damage-inducible when introduced into P. denitrificans cells, whereas recA genes of both P. denitrificans and Rhizobium etli are. These results suggest that the promoters of P. denitrificans and R. etli recA genes have a similar regulatory sequence. A recA-defective mutant of P. denitrificans has also been constructed by replacement of the active recA gene by an in vitro inactivated gene copy.

Cloning, Molecular↗
PubMed1997

Functional analysis of the recA promoter of Rhodobacter capsulatus.

Expression of the Rhodobacter capsulatus recA gene is inducible by DNA damage. By using primer extension and serial deletion, we have identified the promoter of the R. capsulatus recA gene. Electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the R. capsulatus recA promoter containing the imperfect palindromic TTGTACTCATACCATGAGAACAA, which is centered on position-8 with respect to the transcriptional starting site. PCR mutagenesis of both halves of this palindrome indicates that the TTGT and ACAA motifs are necessary both for normal DNA-protein complex formation in vitro and for full DNA damage-mediated induction of recA. Nevertheless, the basal level of recA expression is not increased when both halves of the TTGTN15ACAA sequence are mutagenized. These data suggest that the R. capsulatus recA gene may be regulated by a positive transcription factor which binds to this palindrome.

Base Sequence↗
PubMed1996

nrdD and nrdG genes are essential for strict anaerobic growth of Escherichia coli.

In Escherichia coli ribonucleotide reduction is catalyzed by two separate enzymes during aerobic and anaerobic growth. The aerobic enzyme is coded by the nrdAB genes, the anaerobic enzyme by nrdDG. We now show that knock-out mutants of either nrdD or nrdG cannot grow during strict anaerobiosis, achieved by inclusion of sodium sulfide in the medium. Interestingly, these mutants grow well under microaerophilic conditions by overproducing the aerobic enzyme. Under such conditions wild-type bacteria turn off nrdAB and switch on nrdDG.

Aerobiosis↗
PubMed1996

Cloning of the Rhodobacter sphaeroides hisL gene: unifunctionality of the encoded protein and lack of linkage to other his genes.

The Rhodobacter sphaeroides 2.4.1 hisI gene, which encodes a phosphoribosyl-AMP-cyclohydrolase that catalyses the third step in the histidine biosynthetic pathway, has been isolated from a genomic library of this phototrophic bacterium by complementation of an Escherichia coli hisI mutant. Analysis of the nucleotide sequence of the R. sphaeroides hisI gene reveals that it encodes a deduced product of 119 aa with a predicted molecular mass of 13.4 kDa. In contrast to the situation in E. coli, the R. sphaeroides hisI gene encodes a unifunctional protein and it is not linked to the hisE gene. The absence of a single histidine operon like that of E. coli was confirmed by PFGE experiments and complementation analysis of a R. sphaeroides hisI mutant that was constructed by marker exchange. The location of hisI in the R. sphaeroides genome has been determined to be at map co-ordinate 2275 +/- 20 of chromosome l.

Amino Acid Sequence↗
PubMed1996

The uvrB gene of Pseudomonas aeruginosa is not DNA damage inducible.

The uvrB gene of Pseudomonas aeruginosa has been isolated from a genomic library by complementation of an Escherichia coli uvrB mutant. The complete nucleotide sequence of P. aeruginosa uvrB consists of 2,013 bp, encoding a polypeptide of 670 amino acids. A P. aeruginosa SOS consensus region, which functions as a binding site for the LexA repressor molecule, is not present in the upstream region of the uvrB gene isolated. By transcriptional fusions with a reporter gene, it has been demonstrated that, contrary to what happens with the homologous gene of E. coli, the P. aeruginosa uvrB gene is not DNA damage inducible. Nevertheless, the UvrB protein must be functional in P. aeruginosa cells because a uvrB-defective mutant is extremely sensitive to UV radiation.

Amino Acid Sequence↗
PubMed1995

Two different operons for the same function: comparison of the Salmonella typhimurium nrdAB and nrdEF genes.

By using a P22 phage-mediated cloning system, the nrdAB genes of Salmonella typhimurium (St), encoding a ribonucleotide reductase (RR) of class I, have been isolated. The coding regions of the St nrdAB operon show a very high identity with those of the homologous operon of Escherichia coli (Ec). Nevertheless, there are significant differences in their promoter regions since, although the promoters of both operons present two DnaA boxes, these boxes are located downstream from the transcription start point in St, being upstream in Ec. Moreover, the deduced amino-acid sequences of the St nrdAB showed a very limited overall identity (28%) with the products of St nrdEF, which encode a second class-I RR. Expression of St nrdAB and nrdEF is inducible by hydroxyurea, an inhibitor of RR activity. Alignment of the promoter regions of the nrdAB and nrdEF operons of both St and Ec reveals the presence of a consensus sequence. St is the first organism from which two different RR belonging to the same biochemical class are known.

Base Sequence↗
PubMed1995

Non-reciprocal regulation of Rhodobacter capsulatus and Rhodobacter sphaeroides recA genes expression.

The Rhodobacter capsulatus recA gene has been isolated and sequenced. Its deduced amino acid sequence showed the closest identity with the Rhodobacter sphaeroides RecA protein (91% identity). However, the promoter regions of both R. capsulatus and R. sphaeroides recA genes are only 64% similar. An Escherichia coli-like LexA binding site was not present in the upstream region of the R. capsulatus recA gene. Nevertheless, the R. capsulatus recA gene is inducible by DNA damage in both hetero- and phototrophically growing conditions. The R. capsulatus recA gene is poorly induced when inserted into the chromosome of R. sphaeroides, indicating that the recA gene of both bacteria possess different control sequences despite their phylogenetically close relationship.

Amino Acid Sequence↗
PubMed1995

Cloning, sequence and regulation of expression of the lexA gene of Aeromonas hydrophila.

The lexA gene of Aeromonas hydrophila (Ah) has been isolated by using a specific one-step cloning system. The Ah LexA repressor is able to block Escherichia coli (Ec) SOS gene expression and is likely to be cleaved by the activated RecA protein of this bacterial species after DNA damage. Ah lexA would encode a protein of 207 amino acids (aa), which is 75% identical to the LexA repressor of Ec. Two Ec-like SOS boxes have been located upstream from Ah lexA, the distance between them being 4 bp, whereas this same distance in Ec lexA is 5 bp. The structure and sequence of the DNA-binding domain of the LexA repressor of Ec, as well as the region at which its hydrolysis occurs, are highly conserved in Ah LexA. Moreover, a residue of the region implicated in the specific cleavage reaction, and which is present in all known RecA-cleavable repressors, is changed in the Ah LexA. Expression of Ah lexA is DNA-damage inducible in both the Ah and Ec genetic backgrounds to the same extent. In contrast, Ec lexA is poorly induced in DNA-injured Ah cells.

Aeromonas hydrophila↗
PubMed1994

A second class I ribonucleotide reductase in Enterobacteriaceae: characterization of the Salmonella typhimurium enzyme.

The nrdA and nrdB genes of Escherichia coli and Salmonella typhimurium encode the R1 and R2 proteins that together form an active class I ribonucleotide reductase. Both organisms contain two additional chromosomal genes, nrdE and nrdF, whose corresponding protein sequences show some homology to the products of the genes nrdA and nrdB. When present on a plasmid, nrdE and nrdF together complement mutations in nrdA or nrdB. We have now obtained in nearly homogeneous form the two proteins encoded by the S. typhimurium nrdE and nrdF genes (R1E and R2F). They correspond to the R1 and R2 proteins. Each protein is a homodimer. Together they catalyze the reduction of CDP to dCDP, using dithiothreitol or reduced glutaredoxin, but not thioredoxin, as an electron donor. CDP reduction is strongly stimulated by low concentrations of dATP, presumably acting as an allosteric effector. Protein R2F contains an antiferromagnetically coupled dinuclear iron center and a tyrosyl free radical. The E. coli and S. typhimurium chromosome thus have maintained the information for a potentially active additional class I ribonucleotide reductase, whose role in vivo is as yet unknown. The allosteric regulation of this enzyme differs from that of the normally expressed reductase.

Allosteric Regulation↗
PubMed1994

Interspecies regulation of the recA gene of gram-negative bacteria lacking an E. coli-like SOS operator.

The recA genes of Agrobacterium tumefaciens, Rhizobium meliloti, Rhizobium phaseoli and Rhodobacter sphaeroides, species belonging to the alpha-group bacteria of the Proteobacteria class, have been fused in vitro to the lacZ gene of Escherichia coli. By using a mini-Tn5 transposon derivative, each of these recA-lacZ fusions was introduced into the chromosome of each of the four species, and into that of E. coli. The recA genes of three of the alpha bacteria are induced by DNA damage when inserted in A. tumefaciens, R. phaseoli or R. meliloti chromosomes. The expression of the recA gene of R. sphaeroides is DNA damage-mediated only when present in its own chromosome; none of the genes is induced in E. coli. Likewise, the recA gene of E. coli is not induced in any of the four alpha species. These data indicate that A. tumefaciens, R. meliloti and R. phaseoli possess a LexA-like repressor, which is able to block the expression of their recA genes, as well as that of R. sphaeroides, but not the recA gene of E. coli. The LexA repressor of R. sphaeroides does not repress the recA gene of A. tumefaciens, R. meliloti, R. phaseoli or E. coli.

Agrobacterium tumefaciens↗
PubMed1994

Autoregulation and kinetics of induction of the Rhizobium phaseoli recA gene.

A fusion between the recA gene of Rhizobium phaseoli and the lacZ gene was constructed in vitro and cloned in a mini-Tn5 transposon derivative to obtain chromosomal insertions which make it possible to quantitatively examine their transcriptional regulation in both R. phaseoli and E. coli. Likewise, and by insertion of a spectinomycin-resistance gene cassette into the recA gene of R. phaseoli and subsequent marker exchange, a RecA- derivative of this bacterial species has been obtained. Analysis of this recA-lacZ fusion showed that it was inducible by DNA damage in the RecA+ strain of R. phaseoli but not in the RecA- mutant. On the other hand, the recA-lacZ fusion of R. phaseoli was not induced in DNA-damaged RecA+ cells of E. coli. Furthermore, the range of UV doses which give rise to dose dependence in the induction of its respective recA genes is different in R. phaseoli from that in E. coli.

Cloning, Molecular↗
PubMed1994

Molecular cloning, sequence and regulation of expression of the recA gene of the phototrophic bacterium Rhodobacter sphaeroides.

The recA gene of Rhodobacter sphaeroides 2.4.1 has been isolated by complementation of a UV-sensitive RecA- mutant of Pseudomonas aeruginosa. Its complete nucleotide sequence consists of 1032 bp, encoding a polypeptide of 343 amino acids. The deduced amino acid sequence displayed highest identity to the RecA proteins from Rhizobium meliloti, Rhizobium phaseoli, and Agrobacterium tumefaciens. An Escherichia coli-like SOS consensus region, which functions as a binding site for the LexA repressor molecule was not present in the 215 bp upstream region of the R. sphaeroides recA gene. Nevertheless, by using a recA-lacZ fusion, we have shown that expression of the recA gene of R. sphaeroides is inducible by DNA damage. A recA-defective strain of R. sphaeroides was obtained by replacement of the active recA gene by a gene copy inactivated in vitro. The resulting recA mutant exhibited increased sensitivity to UV irradiation, and was impaired in its ability to perform homologous recombination as well as to trigger DNA damage-mediated expression. This is the first recA gene from a Gram-negative bacterium that lacks an E. coli-like SOS box but whose expression has been shown to be DNA damage-inducible and auto-regulated.

Amino Acid Sequence↗
PubMed1994

Cloning and sequencing of the genes from Salmonella typhimurium encoding a new bacterial ribonucleotide reductase.

A plasmid library of Salmonella typhimurium was used to complement a temperature-sensitive nrdA mutant of Escherichia coli. Complementation was obtained with two different classes of plasmids, one carrying the E. coli nrdAB-like genes and the second containing an operon encoding a new bacterial ribonucleotide reductase. Plasmids harboring these new reductase genes also enable obligately anaerobic nrdB::Mud1 E. coli mutants to grow in the presence of oxygen. This operon consists of two open reading frames, which have been designated nrdE (2,145 bp) and nrdF (969 bp). The deduced amino acid sequences of the nrdE and nrdF products include the catalytically important residues conserved in ribonucleotide reductase enzymes of class I and show 25 and 28% overall identity with the R1 and R2 protein, respectively, of the aerobic ribonucleoside diphosphate reductase of E. coli. The 3' end of the sequenced 4.9-kb fragment corresponds to the upstream region of the previously published proU operon of both S. typhimurium and E. coli, indicating that the nrdEF genes are at 57 min on the chromosomal maps of these two bacterial species. Analysis of the nrdEF and proU sequences demonstrates that transcription of the nrdEF genes is in the clockwise direction on the S. typhimurium and E. coli maps.

Amino Acid Sequence↗
PubMed1994

Bacterial pneumonia in HIV-infected patients: a prospective study of 68 episodes.

We collected clinical and microbiological observations, as well as follow-up on human immunodeficiency virus (HIV)-infected patients with bacterial pneumonia, and compared pneumococcal pneumonia in patients with and without HIV infection. Fifty five HIV-infected patients, who had had 68 episodes of bacterial pneumonia, were studied prospectively. Twenty one HIV-infected patients with pneumococcal pneumonia were compared to 69 non-HIV-infected patients with pneumococcal pneumonia. Aetiological diagnosis was established in 48 cases (71%). The most common causative agents were S. pneumoniae and H. influenzae. Sixty percent of episodes took place in asymptomatic carriers of HIV infection and 37% in acquired immune deficiency syndrome (AIDS) patients. Overall mortality was 10%. Fifty five percent of patients with follow-up had recurrent episodes. Bacteraemic pneumococcal pneumonia was more frequent in HIV- than in non-HIV-infected patients, and the mortality of pneumococcal pneumonia was also higher in HIV- (19%) than in non-HIV-infected (4.3%) patients. We conclude that bacterial pneumonia is a frequent problem in HIV-infected patients and that recurrent episodes are common. The clinical presentation of pneumococcal pneumonia is generally indistinguishable from that occurring in normal hosts, but bacteraemia is more common and the mortality is higher in HIV-infected patients.

AIDS-Related Opportunistic Infections↗
PubMed1993

Analysis of the DNA damage-mediated induction of Pseudomonas putida and Pseudomonas aeruginosa lexA genes.

A fusion between the lexA gene of Pseudomonas aeruginosa and Pseudomonas putida and the lacZ gene was constructed in vitro and cloned in a mini-Tn5 transposon derivative to obtain chromosomal insertions which enable to quantitatively examine their transcriptional regulation in both Pseudomonas and E. coli. Analysis of DNA damage-mediated induction of these lexA-lacZ fusions showed that expression of P. putida and P. aeruginosa lexA genes was always higher and earlier than the expression of the lexA gene of E. coli. Furthermore, and in contrast to the lexA gene fusion of E. coli, the rates and extent of the induction of lexA gene fusion of P. putida and P. aeruginosa were largely independent of the UV doses applied. The behaviour of the lexA-lacZ fusions of two Pseudomonas species was the same regardless of whether they were inserted into their own chromosome or into E. coli.

Bacterial Proteins↗