PubMed Health⌕ Search

Biomedical subjects

J Bautista

Publications and source records attributed to J Bautista.

At least 19 recordsLinked to original sources
PubMed2006

Dysferlin expression in monocytes: a source of mRNA for mutation analysis.

Dysferlin protein is expressed in peripheral blood monocytes. The genomic analysis of the DYSF gene has proved to be time consuming because it has 55 exons. We designed a mutational screening strategy based on cDNA from monocytes to find out whether the mutational analysis could be performed in mRNA from a source less invasive than the muscle biopsy. We studied 34 patients from 23 families diagnosed with dysferlinopathy. The diagnosis was based on clinical findings and on the absence of protein expression using either immunohistochemistry or Western blot of skeletal muscle and/or monocytes. We identified 28 different mutations, 13 of which were novel. The DYSF mutations in both alleles were found in 30 patients and only in one allele in four. The results were confirmed using genomic DNA in 26/34 patients. This is the first report to furnish evidence of reliable mutational analysis using monocytes cDNA and constitutes a good alternative to genomic DNA analysis.

DNA Mutational Analysis↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2005

Feasibility and tolerability of transnasal/per-oral placement of the wireless pH capsule vs. traditional 24-h oesophageal pH monitoring--a randomized trial.

BACKGROUND: The wireless pH is a new technique to monitor oesophageal acid exposure. AIM: To compare the feasibility and tolerability of the wireless pH capsule vs. the traditional pH probe. METHODS: Consecutive patients referred for a pH test were enrolled into the study. Patients were randomized to traditional pH probe, or wireless pH capsule. Patients recorded their activities, food consumption, symptoms, satisfaction with the test and completed a quality of life questionnaire. RESULTS: Of the 50 patients recruited, 25 patients underwent placement of the traditional pH probe, and 25 the wireless pH capsule. Patients with the wireless pH capsule had less nose pain, runny nose, throat pain, throat discomfort and headache as compared with those with the traditional pH probe (P = 0.047, P = 0.001, P = 0.032, P = 0.001, P = 0.009, respectively). Patients in the wireless pH capsule group had more chest discomfort during the pH test (P = 0.037). Patients in the wireless pH capsule group perceived the test as interfering less with their overall daily activities, eating and sleep (P =0.001, P = 0.003, P = 0.025, respectively), and had overall satisfaction with the test (P = 0.023). CONCLUSIONS: Transnasal/per-oral placement of the wireless pH capsule is significantly better tolerated then the traditional pH probe.

Capsules↗
PubMed2004

The effect of an empirical trial of high-dose lansoprazole on symptom response of patients with non-cardiac chest pain--a randomized, double-blind, placebo-controlled, crossover trial.

BACKGROUND: Empirical trial with high-dose omeprazole has been shown to be a sensitive tool for diagnosing patients with gastro-oesophageal reflux disease-related non-cardiac chest pain. AIM: To determine the clinical value of an empirical trial of high-dose lansoprazole in detecting patients with gastro-oesophageal reflux disease-related non-cardiac chest pain. METHODS: Patients who were referred by a cardiologist after a comprehensive evaluation, with at least three episodes per week of unexplained chest pain as the predominant symptom, were enrolled into the study. Oesophageal mucosal disease was determined by upper endoscopy followed by 24-h oesophageal pH monitoring to assess acid exposure. Patients were then randomized to either placebo or lansoprazole 60 mg am and 30 mg pm for 7 days. After a washout period of 1 week, patients crossed over to the other arm of the study for an additional 7 days. Patients completed a daily diary assessing severity and frequency of chest pain as the predominant symptom throughout the baseline treatment and washout periods. The lansoprazole empirical trial was considered diagnostic if chest pain score improved > or =50% than baseline. RESULTS: Of the 40 patients with non-cardiac chest pain that were enrolled, 18 (45%) had erosive oesophagitis and/or abnormal pH test (gastro-oesophageal reflux disease-positive) and 22 (55%) had both tests negative (gastro-oesophageal reflux disease-negative). Of the gastro-oesophageal reflux disease-positive patients, 14 (78%) had significantly higher symptom improvement on lansoprazole than on placebo (22%) (P = 0.0143). Of the gastro-oesophageal reflux disease-negative group, two (9.1%) markedly improved on the medication and eight (36.3%) on placebo (P = 0.75). The sensitivity and specificity of the lansoprazole empirical trial was 78 and 80%, respectively. By day 2, 12 (85.7%) of the gastro-oesophageal reflux disease-related non-cardiac chest pain responders had either complete or almost complete symptom resolution. CONCLUSIONS: The lansoprazole empirical trial is highly sensitive and specific for diagnosing gastro-oesophageal reflux disease-related non-cardiac chest pain patients. The trial enables diagnosing most of the responders within the first 2 days and thus a shorter duration of therapy may be considered in a subset of non-cardiac chest pain patients.

2-Pyridinylmethylsulfinylbenzimidazoles↗
PubMed2004

Efficacy and tolerability of the new antiepileptic drugs I: treatment of new onset epilepsy [RETIRED]: report of the Therapeutics and Technology Assessment Subcommittee and Quality Standards Subcommittee of the American Academy of Neurology and the American Epilepsy Society.

OBJECTIVE: To assess the evidence demonstrating efficacy, tolerability, and safety of seven new antiepileptic drugs (AEDs) (gabapentin, lamotrigine, topiramate, tiagabine, oxcarbazepine, levetiracetam, and zonisamide-reviewed in the order in which these agents received approval by the US Food and Drug Administration) in the treatment of children and adults with newly diagnosed partial and generalized epilepsies. METHODS: A 23-member committee, including general neurologists, pediatric neurologists, epileptologists, and doctors in pharmacy, evaluated the available evidence based on a structured literature review including MEDLINE, Current Contents, and Cochrane library for relevant articles from 1987 until September 2002, with selected manual searches up until 2003. RESULTS: There is evidence either from comparative or dose-controlled trials that gabapentin, lamotrigine, topiramate, and oxcarbazepine have efficacy as monotherapy in newly diagnosed adolescents and adults with either partial or mixed seizure disorders. There is also evidence that lamotrigine is effective for newly diagnosed absence seizures in children. Evidence for effectiveness of the new AEDs in newly diagnosed patients with other generalized epilepsy syndromes is lacking. CONCLUSIONS: The results of this evidence-based assessment provide guidelines for the prescription of AEDs for patients with newly diagnosed epilepsy and identify those seizure types and syndromes where more evidence is necessary.

Acetates↗
PubMed2004

Efficacy and tolerability of the new antiepileptic drugs II: treatment of refractory epilepsy [RETIRED]: report of the Therapeutics and Technology Assessment Subcommittee and Quality Standards Subcommittee of the American Academy of Neurology and the American Epilepsy Society.

OBJECTIVE: To assess the evidence demonstrating efficacy, tolerability, and safety of seven new antiepileptic drugs (AEDs) (gabapentin, lamotrigine, topiramate, tiagabine, oxcarbazepine, levetiracetam, and zonisamide) in the treatment of children and adults with refractory partial and generalized epilepsies. METHODS: A 23-member committee including general neurologists, pediatric neurologists, epileptologists, and doctors in pharmacy evaluated the available evidence based on a structured literature review including MEDLINE, Current Contents, and Cochrane library for relevant articles from 1987 until March 2003. RESULTS: All of the new AEDs were found to be appropriate for adjunctive treatment of refractory partial seizures in adults. Gabapentin can be effective for the treatment of mixed seizure disorders, and gabapentin, lamotrigine, oxcarbazepine, and topiramate for the treatment of refractory partial seizures in children. Limited evidence suggests that lamotrigine and topiramate are also effective for adjunctive treatment of idiopathic generalized epilepsy in adults and children, as well as treatment of the Lennox Gastaut syndrome. CONCLUSIONS: The choice of AED depends upon seizure and/or syndrome type, patient age, concomitant medications, AED tolerability, safety, and efficacy. The results of this evidence-based assessment provide guidelines for the prescription of AEDs for patients with refractory epilepsy and identify those seizure types and syndromes where more evidence is necessary.

Acetates↗
PubMed2001

Mitochondrial DNA point mutation in the COI gene in a patient with McArdle's disease.

We studied a 57-year-old female patient with clinical and biochemical evidences of McArdle's disease. Her muscle biopsy also revealed signs of mitochondrial proliferation, scattered RRF, and a deficit in complex I of the respiratory chain. Molecular genetic analysis showed that the patient was heterozygous for the most common mutation at codon 49 in the myophosphorylase gene. Mitochondrial DNA analysis of muscle tissue revealed an additional G-to-A transition at nucleotide position 7444 in the cytochrome c oxidase subunit I (COI) gene.

Codon↗
PubMed2001

Processing of crawfish (Procambarus clarkii) for the preparation of carotenoproteins and chitin.

Crawfish carotenoproteins and chitin are obtained by a combined process based on flotation-sedimentation and in situ lactic acid production. The carotenoprotein PF(1) obtained has a high content in essential amino acids, w-3-fatty acids, and carotene (mainly astaxanthin) and constitutes an excellent nutritional source for patients with malnutrition. The carotenoprotein PF(2) has a lower nutritional quality but with a substantial carotene content can be used as a feed for animals where coloration is required, such as salmon and trout bred under aquaculture. Chemical and spectrometric (FTIR and (13)C NMR) characterization shows the obtained chitin to be of high quality, similar to that available commercially, for medical and nutritional uses.

Animals↗
PubMed2001

Mitochondrial disease and stroke.

BACKGROUND AND PURPOSE: It is well known that some mitochondrial disorders are responsible for ischemic cerebral infarction in young patients. Our purpose was to determine, in this prospective ongoing study, whether ischemic stroke is the only manifestation of a mitochondrial disorder in young patients. METHODS: Patients aged </=50 years, admitted to the Stroke Unit from January 1999 to May 2000 with a diagnosis of ischemic stroke of unknown origin, were included in the study. All of them had full biochemical and hematologic tests, neuroimaging studies, transesophageal echocardiography, and extracranial and transcranial Doppler sonography. Patent foramen ovale was ruled out. Lactic acid concentrations were measured after anaerobic exercise of the forearm, and a morphological, biochemical, and molecular study after biceps muscle biopsy was performed. RESULTS: Of the 18 patients so far included, 3 (17%) presented lactic acid hyperproduction after physical exercise, and 6 (33%) showed deficit of the mitochondrial respiratory chain complexes. The molecular analyses have confirmed mitochondrial mutations at base pairs 3243 (characteristic of mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes [MELAS]), 4216, and 15 928. CONCLUSIONS: These results suggest that ischemic stroke may be the only manifestation or the initial manifestation of a mitochondrial disorder.

Adolescent↗
PubMed2000

Brain mitochondrial complex I inactivation by oxidative modification.

In vitro oxidation of the brain mitochondrial complex I by the hydroxyl radical generating system ascorbate/Fe(III)/O(2) has been carried out. Complex I inactivation, by oxidation, has been studied using a method based on the resolution of proteins by blue native polyacrylamide gel electrophoresis (BN-PAGE), followed by total protein quantification by staining with Coomassie brilliant blue, in-gel activity quantification, and quantification of oxidized proteins by labelling with DIG-hydrazide and immunodetection with an anti-DIG-AP. Quantification was carried out by densitometry procedure. Our results show that oxidation is a continuous process, increasing rapidly at the beginning, reaching a plateau after 8 h of incubation. There is practically no inactivation until a threshold value of damage is reached. Below this, the complex activity is resistant to the aggression of oxygen-reactive substances and free radicals, but once the threshold value is passed, activity is lost rapidly.

Animals↗
PubMed2000

[The use of cardiopulmonary exercise test in patients with mitochondrial myopathies].

BACKGROUND: Exercise tests has been used in the diagnosis of metabolic myopathies. If there is an abnormal response pattern in mild mitochondrial myopathy (MM) and her role in the initial suspect diagnostic is unknown. SUBJECTS AND METHODS: Prospective study of 26 patients with mitochondrial myopathy (15 men, 11 women) and a control group of 14 sedentary volunteers (9 men, 5 woman) with similar antropometric characteristics. We have made pulmonary function tests and treadmill exercise with serial venous sampling of blood lactate, piruvate, ketone bodies, free fatty acids and creatinkinase. RESULTS: Patients with MM showed exercise limitation with lower maximal power (MM = 143 [47] vatts, C = 187 [40] vatts, p = 0.006), maximal oxygen uptake (MM = 27 [8] ml/min/kg, C = 40 [7] ml/min/kg, p = 0.001) and maximal oxygen pulse (MM = 11 [3] ml/beat, C = 14 [3] ml/beat, p = 0.006). For the same oxygen uptake the heart rate was higher and the anaerobic threshold was earlier in MM patients (MM = 48% [14], C = 62% [12], p = 0.01). We found a considerable slower maximal oxygen uptake in patients with lipid increase in muscle biopsy (n = 15). Acetoacetate curves, beta-hydroxybutyrate, free fatty acids and creatinkinase were similar in both groups. The exercise test was pathologic in 17/26 of the patients. The sensitivity of the exercise test for maximal oxygen uptake was 0.65. CONCLUSIONS: The cardiopulmonary exercise test is a useful test in the suspect initial diagnostic of patients with mild mitochondrial myopathy because the majority of patients show a pathologic test.

Adolescent↗
PubMed2000

Lipomatosis, proximal myopathy, and the mitochondrial 8344 mutation. A lipid storage myopathy?

Multiple symmetric lipomatosis (MSL) has been related in some cases to the 8344 point mutation of the tRNA-lysine gene of the mitochondrial DNA, mainly in the context of families with classic myoclonic epilepsy with ragged-red fibers (MERRF) and exceptionally in patients with proximal myopathy as the only manifestation of mitochondrial disease. We report on two families harboring the 8344 mutation. The patients presented with MSL and myopathy, expressed as limb girdle weakness in index cases and as exercise intolerance in the others. All muscle biopsies performed showed lipid storage apart from RRF and respiratory chain complexes deficiency. A possible explanation for both adipose proliferation and lipid storage myopathy in these cases is a disturbance in intermediary lipid metabolism secondary to mitochondrial respiratory chain deficiency that could be related via carnitine deficiency.

Adolescent↗
PubMed2000

Molecular analysis of Spanish patients with AMP deaminase deficiency.

We found six patients with AMPD deficiency in muscle who were homozygous for the most common mutation, Q12X in the AMPD gene (AMPD1), associated with this disease. Three patients had AMPD deficiency alone, showing a mild clinical phenotype. Two patients showed a defect of PPL in muscle, and were homozygous for the most common mutation associated with McArdle's disease, R49X in the muscle PPL gene (PYGM). In one of these patients, the clinical phenotype was more severe than usually seen in patients with McArdle's disease. The remaining patient harbored the mtDNA A3243G mutation, showing one of the usual clinical patterns associated with this mutation. We conclude that the Q12X mutation in AMPD1 may result in a mild clinical effect; that it is frequent in the Spanish population, and therefore frequently associated with other metabolic diseases; and that the effect of the association of AMPD and PPL deficiencies seems to be neutral.

AMP Deaminase↗
PubMed1999

Alkylating agents from sugars. Alkyl hexopyranoside derivatives as carrier systems for chlorambucil.

Chlorambucil derivatives involving alkyl 2-aminodeoxy sugars have been synthesized in good yield by coupling the chlorambucil moiety to positions C-2 or C-3 of the sugar, directly or via a spacer. The starting material was easily available from 2-acetamido-2-deoxy-D-glucose. The final compounds were tested for cytotoxicity, and some of those that presented the best results were studied for inhibition of cell proliferation.

Adult↗