PubMed HealthSearch

Biomedical subjects

J C Rogers

Publications and source records attributed to J C Rogers.

At least 19 recordsLinked to original sources

The importance of DNA methylation for stability of foreign DNA in barley.

We developed a system using 'passive' reporter genes driven by aleurone tissue-specific promoters to test the effect of methylation of foreign DNA on its stability after introduction into barley plants. The foreign DNA was introduced into barley cells and was able to persist through at least two plant generations. Transformation of barley cells was defined by showing initiation of transcription at the proper site on the barley promoter for the chimeric gene in aleurone tissue from both a primary transformant and its progeny, and by tissue-specific expression (aleurone greater than leaf) in the progeny. This persistence through many multiples of cell division is formally equivalent to transformation, regardless of whether the DNA was chromosomally integrated or carried as an episome, but did not necessarily represent stable integration into the genome since the foreign DNA was frequently rearranged or lost. The foreign DNA was most stable when plasmid DNA used in transformation lacked dA methylation but had complete methylation of dC residues in the CG dinucleotide at Hpa II sites; dA methylation alone was associated with marked foreign DNA instability. Our results are consistent with the presence of a previously undefined system in barley that identifies DNA lacking the proper methylation pattern and causes its loss from actively dividing cells. These results may be important when applied to different strategies using selectable markers for cereal transformation.

Base Composition

Differences between patient and physician perceptions of predicted compliance.

One approach to improving patient compliance is for physicians to adapt their behaviour to fit patients' psychological characteristics. Previous university-based research has suggested that physician adaptation to patients' locus of control interferes with patient-physician congruence on expected compliance, but not with congruence on satisfaction with their relationship. This study was conducted in a community practice to clarify the relationship between the physician's adaptation to locus of control and likelihood of and commitment to compliance, and satisfaction with the doctor-patient match. One physician saw 148 patients with a variety of illnesses after they had completed the Health Locus of Control (HLC) questionnaire. The physician altered how he spoke with a patient based on whether the patient scored internally or externally on the HLC. After the encounter, both patient and physician rated the patient's likelihood of and commitment to complying with each of the three recommendations. The physician and each patient also rated their satisfaction with the match between them. Patients' ratings of commitment, likelihood, and satisfaction were significantly higher than those of the physician. Unlike earlier results, there were strong correlations between the patients' and physician's estimates of compliance (commitment and likelihood). Just as with the previous study, there was no correlation between the levels of physician and patient satisfaction with their match. This study indicates that physician adaptation to patients' locus of control does not interfere with compliance outcomes of doctor-patient encounters. Whether such adaptation will improve compliance outcomes is yet to be determined.

Adult

Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes.

The mechanisms by which cis-acting hormone response elements affect transcription is unclear. In this study, we demonstrated that a second "coupling element," identified as O2S, must be present to allow a single copy of either the gibberellin response element (GARE) or the abscisic acid response element (ABRE) to mediate their hormonal effects in the barley Amy32b alpha-amylase gene promoter. The interactive effects of the O2S and the GARE are constrained positionally and spatially; thus, together they form a gibberellin response complex (GARC). The absolute requirement of the O2S for function of the ABRE demonstrates that these together form an abscisic acid response complex (ABRC). A second copy of the GARE can substitute for the O2S in the GARC, but only in one orientation. By expressing the GARC-containing and ABRC-containing promoters in developing aleurone tissue, we showed that hormonal effects prevent alpha-amylase gene expression during the second half of grain development, but other mechanisms suppress expression earlier. Our results suggest that the specific sequence serving as a coupling element in a given gene promoter will greatly affect where and when the GARE or ABRE will be able to regulate transcription.

Abscisic Acid

A gibberellin response complex in cereal alpha-amylase gene promoters.

The Amy32b gene is a representative member of a closely related family of alpha-amylase genes expressed under hormonal control in aleurone layers of barley grains. Transcription of this gene is induced by gibberellin (GA) and suppressed by abscisic acid. In this study, we functionally defined the promoter elements of the Amy32b gene that govern the developmental and hormonal control of its expression in aleurone. Two functionally distinct yet physically associated elements are essential: a gibberellin response element mediates regulation by GA and abscisic acid, and an Opaque-2 binding sequence (O2S) is thought to interact with a barley homolog of the maize endosperm-specific transcriptional regulator Opaque-2. An additional element CCTTTT, which with the O2S forms part of a canonical "endosperm box," is important in modulating the absolute level of expression of the Amy32b promoter, as is another separate, highly conserved element TATCCATGCAGTG.

Abscisic Acid

Proaleurain vacuolar targeting is mediated by short contiguous peptide interactions.

Targeting of soluble proteins to the plant vacuole is mediated by determinants that reside in the polypeptide. We identified the vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease, by incorporating different sequences from proaleurain into the secreted thiol protease, proendoproteinase B (proEP-B), and vice versa. The targeting fates of the chimeric proteins were analyzed by transient expression in electroporated tobacco protoplasts. The targeting determinant SSSSFADSNPIR is positioned at the N terminus of the aleurain propeptide, and its substitution into the propeptide of EP-B caused vacuolar targeting of the resulting chimeric protein. This determinant can be divided into two smaller determinants, SSSSFADS and SNPIR, each of which is sufficient to target proEP-B chimeras to the vacuole, but with lower efficiency. These smaller determinants interact in a positive manner because the combined determinant SSSSFADSNPIR targeted proEP-B with an efficiency greater than each of the smaller determinants alone. Accordingly, the efficiency of aleurain targeting was decreased when either of the smaller determinants was disrupted by replacement with similarly positioned proEP-B sequences. Further experiments on proaleurain identified an additional determinant, VTDRAAST, adjacent to the SSSSFADSNPIR determinant that is also necessary for efficient vacuolar targeting. Our results provide evidence that efficient vacuolar targeting of this thiol protease in plant cells is mediated by the combined action of smaller contiguous determinants; two of these alone are sufficient for vacuolar targeting.

Amino Acid Sequence

Assistive technology device use in patients with rheumatic disease: a literature review.

Occupational therapists often prescribe assistive technology devices (ATDs) to assist persons with disabilities in performing daily living tasks. Estimates suggest that although most ATDs are used, a substantial proportion are never used or are discarded shortly after they are obtained. A review of the literature on ATDs was carried out to identify factors that contribute to ATD use and disuse. The review focused on persons with osteoarthritis and rheumatoid arthritis, because such persons are frequent users of ATDs. Although the literature review highlighted person-, environment-, and ATD-related factors as relevant to ATD use, it also underscored the dearth of scientific study of the prescription, provision, and use of ATDs. A model is proposed to guide empirical research aimed at identifying non-device users from the outset of treatment so that interventions to improve ATD use may be initiated or alternative interventions implemented. The variables comprising the model pertain to the patient, the patient's living environment, the therapist prescribing the device, and the device itself.

Activities of Daily Living

Improving prescription documentation in the ambulatory setting.

Use of a standard prescription pad, although it adequately meets the needs of drug delivery, requires the physician to document prescribed medications separately in the medical record. Failure to do so may lead to under-recognition of problems of potential drug interactions and adverse drug reactions, delays in prescription refills, and other areas of quality of care, especially in a setting where multiple physicians may be involved in the care of a patient. Of 83 prescriptions written in a primary care clinic, only 11 (13%) were noted on the chart medication form when physicians used prescription pads. Implementation of a "one-write" noncarbon prescription form that generated an instant copy increased prescription documentation to 83% (49 of 59 prescriptions) (x2 = 68.86; p < 0.005) over a one-week period. In a follow-up study conducted approximately 3.5 years after the initial intervention, use of the "one-write" form had maintained at 82% prescription documentation (32 of 39) prescriptions) (x2 = 52.05; p < 0.005). A "one-write" copy system could improve clinical care by improving medication documentation in the medical record.

Ambulatory Care

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Abscisic Acid

A copy of exon 3-intron 3 from the barley aleurain gene is present on chromosome 2.

A genomic clone from Hordeum vulgare L. cv. Himalaya contains 700 bp of DNA that is homologous with a high degree of nucleotide sequence similarity to exon 3-intron 3 from the gene for the thiol protease, aleurain. Genomic Southern blot mapping data indicate that this clone in phage lambda had not undergone rearrangement, and no other sequences homologous to aleurain are present on it. Although exon 3 in aleurain encodes the polypeptide region cleaved during proteolytic processing of the proenzyme to its mature form, we do not know if the copy is expressed in some other protein. We have mapped the aleurain gene to chromosome 1, and this copy of exon 3-intron 3 to chromosome 2.

Base Sequence

Teaching medical decision making and students' clinical problem solving skills.

Medical students need to be taught explicitly about decision making to be prepared for the changing health care environment. Medical decision making curricula have received favourable responses from students and have influenced some aspects of student performance. Questions remain about the impact of the teaching on students' general problem solving skills. A 15 hour course covering decision making topics was presented during a preclinical elective preceptorship for 5 years. Problem solving ratings made by clinical supervisors for the third year psychiatry and internal medicine clerkships were not better for the students who had the instruction and clinical experience than for the students in the comparison group. The results suggest that this approach to teaching decision making requires further development and testing.

Curriculum

Occupational therapy diagnostic reasoning: a component of clinical reasoning.

The occupational therapy process involves the assessment and treatment of problems in occupational status. Assessment entails the sensing and defining of patients' problems and is accomplished through diagnosis. As a process, diagnosis involves the creation of a clinical image of the patient through cue acquisition, hypothesis generation, cue interpretation, and hypothesis evaluation. This sequence of cognitive activities is called diagnostic reasoning. As a product, diagnosis summarizes a patient's occupational deficits in terms of occupational role performance, occupational performance, and the components of occupational performance. To serve adequately as a basis for planning intervention, the occupational therapy diagnosis describes the problem, explains the potential cause of the problem, gives the cues whereby the problem is recognized, and names the pathologic agent. Occupational therapy assessment is broader than diagnosis and includes a delineation of the patient's assets as well as deficits. In the resolution of problems in occupational status, assets may be used to offset deficits. The clinical image represents a balanced view of occupational status by reflecting assets and deficits.

Clinical Competence

Muramic acid is not detectable in Chlamydia psittaci or Chlamydia trachomatis by gas chromatography-mass spectrometry.

By using the powerful separation technique of capillary gas chromatography combined with the selectivity of mass spectrometric detection, muramic acid was not detectable in purified elementary bodies of Chlamydia psittaci Cal 10 (less than or equal to 0.006%) or C. trachomatis serovar E (less than or equal to 0.02%). This confirms previous reports which suggested the absence of a typical peptidoglycan in Chlamydia spp.

Chlamydia trachomatis

Chemotaxonomic differentiation of legionellae by detection and characterization of aminodideoxyhexoses and other unique sugars using gas chromatography-mass spectrometry.

Legionellae have been differentiated previously by analyzing their carbohydrate contents by gas chromatography with flame ionization detection. In the present study, total ion mode gas chromatography-mass spectrometry (GC-MS) was used to detect a number of unusual sugars, including one that is structurally related to O-methyldideoxyheptoses. Increased sensitivity and selectivity for carbohydrate detection was achieved by selected ion-monitoring GC-MS. Two of the uncommon sugars previously discovered in the legionellae (X1 and X2) were identified as quinovosamine and fucosamine, respectively. Legionella pneumophila contained rhamnose and quinovosamine but not the quinovosamine isomer fucosamine. Tatlockia micdadei and Legionella maceachernii contained large amounts of rhamnose, fucose, and fucosamine but not quinovosamine. These two species were the only legionellae studied that contained another unusual sugar that is referred to as X3, pending determination of its structure. Fluoribacter dumoffi, Fluoribacter bozemanae, and Legionella anisa were varied in their carbohydrate contents, both within and between species, but could be distinguished from L. pneumophila and the T. micdadei and L. maceachernii group. Fluoribacter gormanii was unique among the legionellae in that it lacked both quinovosamine and fucosamine. Legionella jordanis contained other unusual carbohydrates in addition to quinovosamine. GC-MS may have wide application in the differentiation of bacterial species.

Amino Sugars

Assessing threats to the validity of experimental and observational designs.

Experimental designs, particularly the randomized trial, are viewed as the most scientifically rigorous methods by which knowledge is attained. Most clinical disciplines, however, use observational study designs more frequently than experimental designs. Nevertheless, the scientific rigor of experimental designs can be approximated by observational designs if common internal validity threats are recognized and addressed during the development of the research protocol. This paper presents a model of threats that can be applied to both types of designs to compare their scientific merits.

Case-Control Studies