Biomedical subjects

J F Lefèvre

Publications and source records attributed to J F Lefèvre.

33 records · Page 2Linked to original sources

PubMed1994

Protein dynamics.

Modern NMR has revitalized the study of protein dynamics. Multidimensional spectra and the heteronuclear spectroscopy allow a substantial gain in resolution. Dynamics can be analyzed at individual sites and data on segmental and sequence-dependent flexibility are accumulating. This review summarizes the wide variety of NMR approaches for observing internal motions, including the folding processes, and the attempts to correlate dynamics to the biological activity of proteins. The implications of mobility on structure determination by NMR is also discussed.

Magnetic Resonance Spectroscopy↗

PubMed1994

Nuclear magnetic resonance measurements of slow conformational dynamics in macromolecules.

The combined use of rotating-frame relaxation methods, temperature-dependent measurements of line shapes and magnetization transfer experiments allows in favorable cases the examination in some detail of exchange processes that occur on the millisecond time scale. It is possible to determine not only the rate constants, but also the activation parameters and chemical shifts even for events that are in fast exchange on the chemical shift time scale. Such measurements complement the information obtainable from heteronuclear relaxation methods that probe mainly the fast librational motions in macromolecules and may provide information important for functional studies of biological macromolecules.

Amino Acid Sequence↗

PubMed1994

Structural studies of two antiaggregant RGDW peptides by 1H and 13C NMR.

The structural features of Arg-Gly-Asp-related sequences have been investigated by 1H and 13C NMR. Two linear peptides which inhibit platelet aggregation with a high efficiency have been studied: D-Arg-Gly-Asp-Trp and L-Arg-Gly-Asp-Trp. Analysis of pH titration effects, amide proton exchange rates and inter-proton distances obtained from ROESY spectra suggest that these small fragments predominantly adopt a type II' beta-turn structure in solution. Folding features of a non-active cyclic peptide based on the same sequence (cyclo-[Arg-Gly-Asp-Trp]2) have also been investigated. The biological relevance of these structures is discussed.

Amino Acid Sequence↗

PubMed1993

Structural and dynamic studies of two antigenic loops from haemagglutinin: a relaxation matrix approach.

We have investigated the dynamics and structural behaviour of two antigenic peptides using 1H NMR. The two cyclic peptides mimic the antigenic site A of influenza haemagglutinin protein; they only differ in the way they were cyclized and in the size of their respective linkers. Homonuclear relaxation parameters extracted from a complete NOE matrix were interpreted in terms of local dynamics. A set of distance constraints was deduced from these parameters which allowed 3D models to be constructed using distance geometry. NOE back-calculation was used to check the validity of the final models. Strong variations of internal motion amplitude have been found in both peptides along their backbone. Motions with high amplitudes have been localized in the Gly-Pro-Gly sequence which forms a beta-turn in both structures.

Amino Acid Sequence↗

PubMed1992

Computing the geometry of a molecule in dihedral angle space using n.m.r.-derived constraints. A new algorithm based on optimal filtering.

We have developed a method based on optimal filtering to determine the three-dimensional structure of a protein from n.m.r.-derived constraints, using the dihedral angle internal representation of the molecule. It differs from currently proposed methods in that it directly produces estimates of errors on the parameters that are refined, hence providing an image of the minimum that has been found. A similar algorithm had already been proposed using cartesian co-ordinates as independent parameters, encoded in PROTEAN2. We found that using dihedral angles significantly reduces the computational burden of the technique, and provides better control over a priori informations that can be used, such as geometric restrictions for proline residues and informations from vicinal coupling constants. Performance of the method, encoded in FILMAN, is demonstrated by application to the folding of a ten-residue alanine polypeptide, to the geometric cyclization of an 11-residue peptide, as well as on the folding of a medium size protein, i.e. tendamistat. The validity of the error estimates on the dihedral angles produced by FILMAN is discussed.

Algorithms↗

PubMed1990

Kinetic studies of the modulation of ada promoter activity by upstream elements.

We have determined the kinetics of initiation of transcription of the wild-type ada promoter by abortive initiation assays. In the absence of activation, it is a weak promoter, with an association constant KB and an isomerization rate constant k2 comparable to those obtained under the same conditions for other positively regulated promoters (0.36 x 10(7) M-1 and 1.7 x 10(-2) s-1, respectively, at 37 degrees C and 50 mM NaCl, on a supercoiled template). As already observed for other promoters, these constants are modulated by varying the supercoiling of the plasmid. However, the strength of the promoter (given by the KB.k2 product) remains almost constant, because the maximum value of KB and k2 are obtained for different values of the superhelical density. The ada promoter has a stretch of seven adenosine residues (A7) in its upstream region. We have analysed the effect of this upstream sequence on the efficiency of initiation of the ada promoter by comparing the wild-type sequence with an up-mutant promoter characterized by the inversion of the central base pair in the sequence (A7) leading to the sequence (A3TA3). Although the mutation, which is located outside the promoter consensus regions, has no effect on the isomerization step, it affects the equilibrium constant KB that characterizes the association step. In the mutant promoters, the supercoiling of the plasmid modulates the isomerization and association constants in such a way that both KB and k2 are maximum for the same superhelical density (-0.05), leading to a 12-fold increase of the strength of the promoter, on a supercoiled template.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

PubMed1989

Strong structural effect of the position of a single acetylaminofluorene adduct within a mutation hot spot.

The NarI restriction enzyme recognition site, G1G2CG3CC, has been identified as a hotspot for -2 frameshift mutations induced by N-2-acetylaminofluorene (AAF) on the basis of a forward mutation assay in plasmid pBR322 in the bacterium Escherichia coli. AAF binds primarily to the C-8 position of guanine residues, and the three guanines of the NarI site are similarly reactive. Despite this similar chemical reactivity, only binding of AAF to the G3 residue causes the -2 frameshift mutations. To study the mechanisms underlying the specificity of the mutagenic processing further, we monitored the structural changes induced by a single AAF adduct within the NarI site by means of CD spectroscopy and thermal denaturation. The NarI sequence was studied as part of the 12-mer ACCGGCGCCACA. The purification and characterization of the three isomers having a single AAF adduct covalently bound to one of the three guanines of this 12 mer are described. The analysis of the melting profiles of the duplexes formed when these three isomers are annealed with the oligonucleotide of complementary sequence shows the same destabilizing effect of the AAF adduct on the three DNA helices. It is also shown, from the CD spectra, that modification of guanine G1 or G2 by AAF does not induce major changes in the helical structure of DNA. On the other hand, modification of guanine G3 induces a change in the CD signal that suggests the formation of a local left handed structure within the 12-mer duplex. These results show the polymorphic nature of the DNA structure in the vicinity of an AAF adduct.

2-Acetylaminofluorene↗

PubMed1988

A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli.

Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.

Base Sequence↗

PubMed1987

Solution structure of the Trp operator of Escherichia coli determined by NMR.

We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-mer. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J. Mol. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.

Base Sequence↗

PubMed1987

The interaction of the trp repressor from Escherichia coli with the trp operator.

We have examined the interaction of the trp repressor from Escherichia coli with a 20 base-pair synthetic operator. Nonspecific binding was relatively strong (Kd = 2 microM), but only weakly sensitive to the concentration of added salt [d log Kd)/(d log [Na]) = -1). 1H-NMR studies indicate that the structure of the repressor is not greatly altered on forming the complex, and that few if any of the lysine and arginine residues make direct contact with the DNA. However, the mobility of one of the two tyrosine residues is significantly decreased in the complex. The repressor makes close contact with the major grooves of the operator such that the base protons are broadened much more than expected on the basis of increased correlation time. There are large, differential changes in chemical shifts of the imino protons on forming the complex, as well as changes in the rate constants for exchange. The fraying of the ends is greatly diminished, consistent with a target size of about 20 base-pairs. The effects of the repressor on the NMR spectra and relaxation rate constants can be interpreted as a change in the conformation of the operator, possibly a kinking in the centre of the molecule.

Bacterial Proteins↗

PubMed1987

Fast abortive initiation of uvrA promoter in a supercoiled plasmid studied by stopped-flow techniques.

In order to follow the fast kinetics of abortive initiation (lag time from 1 ms to 10 s), we have built a stopped-flow apparatus equipped for fluorescence detection. The small volume used for each assay (35 microliters), and the short dead time (approximately 0.5 ms) are the essential advantages of this apparatus. Supercoiling of DNA affects considerably the initiation of transcription from the uvrA promoter. It decreases the lag time due to the isomerisation process 3-fold. Nevertheless, it does not change significantly the product KBk2, which is indicative of promoter strength and shows that uvrA is an 'association-limited' promoter. The presence of the LexA repressor increases the lag time considerably. At least for small RNA polymerase concentrations this increase is stronger for supercoiled than for linearized DNA.

Bacterial Proteins↗

PubMed1986

The effect of the trp repressor from Escherichia coli on the structure and dynamics of dA20dT20.

We have determined the effect of the tryptophan (trp) repressor from Escherichia coli on the structure and dynamics of dA20dT20. The structure was determined using time-dependent nuclear Overhauser effects and spin-lattice relaxation times. The deoxyribose conformation is near C3' endo for the thymine residues, and a mixture of about 30% C3' endo and 70% C2' endo for the adenine residues. The glycosidic torsion angles are -50 degrees for T and -60 degrees for A. The roll is 20 degrees and the propellor twist is about 29 degrees. The conformation is consistent with recent calculations (Rao, K. and Kollman, P.A. (1985) J. Am. Chem. Soc. 107, 1507-1511). The rate constant for exchange of the imino protons is similar to that usually found for AT base-pairs, with an activation energy of 20 +/- 2 kcal/mol, and an activation entropy of 17 +/- 7 cal/mol per K. The repressor greatly retards the exchange of imino protons, and the activation energy increases to 38 kcal/mol. There are small changes in the structure of the DNA on forming the complex, with the adenine and thymidine residues becoming more similar in conformation.

Bacterial Proteins↗

PubMed1984

A new experimental approach for studying the association between RNA polymerase and the tet promoter of pBR322.

In order to follow the kinetics of the initiation of transcription by the E. coli RNA polymerase, we have used the procedure of abortive initiation as described by Mc Clure (1980) (7). In place of radioactive labeling we have taken advantage of a fluorescent probe (UTP gamma ANS) to obtain fast and accurate determinations of the rate of transcription and to deduce from kinetic equations both the binding constant (KB) and the rate of isomerization (k2) which characterize the classical two-step model. This analysis was applied to the tet promoter of pBR322 in a linearized plasmid DNA and was studied in function of temperature (from 25 degrees C to 37 degrees C) and of pH (from 6 to 8.3). The association is entropy driven (delta H degrees = 29 Kcal/mole and delta S degrees = 130 e.u.). The activation energy of isomerization is 13 Kcal/mole. Both k2 and k-2 are increasing with pH. The insensitivity to pH of the KBK2 product could be tentatively explained in terms of the processive aspect of the polymerase binding to its specific site.

DNA-Directed RNA Polymerases↗

PubMed1978

Comparative studies on the 7-iodo and 7-fluoro derivatives of N-acetoxy-N-2-acetylaminofluorene: binding sites on DNA and conformational change of modified deoxytrinucleotides.

GMP and native DNA were reacted with 7-iodo and 7-fluoro derivatives of N-acetoxy-N-2-acetylaminofluorene. It was shown that the 7-halogeno derivatives react on C-8 of guanine. Furthermore the respective amount of arylamidation (covalent linkage on the C-8 of guanine) and arylation (covalent linkage on 2-NH2 groups of C3 of guanine) addition products was determined in both native and denatured DNA-[14C]AAIF. Two G containing deoxytrinucleotides modified by either AAFF or AAIF were studied comparatively by means of circular dichroism, and as a function of several parameters known to affect the conformation of the deoxytrinucleotides. The induced optical activity in fluorofluorene ring seemed to be very sensible to the conformational changes of the deoxytrinucleotides. On the other hand, the AAIF residue exhibit a lower induced optical activity which remained unchanged when the deoxytrinucleotides conformation was affected. The results presented in this paper led us to conclude that the AAFF and AAIF modified deoxytrinucleotides adopt a conformation which nicely fits with the insertion-denaturation and outside-binding model, respectively.

Acetoxyacetylaminofluorene↗

PubMedDate not supplied

Modelling the dynamics of an antigenic peptide using NMR relaxation data.

The internal dynamics of a cyclic peptide which was designed to mimic an antigenic loop of the haemagglutinin, is studied through heteronuclear relaxation along the 13C alpha-1H alpha vectors and through homonuclear relaxation along the 1H alpha-1HN and 1H beta-1H beta' vectors. Order parameters are extracted from the longitudinal and cross-relaxation data. Molecular dynamics simulations are performed and the order parameters are calculated in different ways from the trajectories. The simulation, which is performed in vacuo, gives smaller order parameters (vector motions of larger amplitude) than the experimental results. However, the general features of the experimental order parameters are reproduced by the molecular dynamics simulation. The flexibility of the molecule can then be investigated from the results of the molecular dynamics. It shows that the mobility observed through the order parameters is due to motions in flanking regions, remote from the observed vectors.

Amino Acid Sequence↗