PubMed Health⌕ Search

Biomedical subjects

J H Ryan

Publications and source records attributed to J H Ryan.

9 recordsLinked to original sources
PubMed2001

Improved MtDNA sequence analysis of forensic remains using a "mini-primer set" amplification strategy.

Mitochondrial DNA (mtDNA) analysis of highly degraded skeletal remains is often used for forensic identification due largely to the high genome copy number per cell. Literature from the "ancient DNA" field has shown that highly degraded samples contain populations of intact DNA molecules that are severely restricted in size (1-4). Hand et al. have demonstrated the targeting and preferential amplification of authentic human DNA sequences with small amplicon products of 150 bp or less (1,2). Given this understanding of ancient DNA preservation and amplification, we report an improved approach to forensic mtDNA analysis of hypervariable regions 1 and 2 (HV1/HV2) in highly degraded specimens. This "mini-primer set" (MPS) amplification strategy consists of four overlapping products that span each of the HV regions and range from 126 to 170 bp, with an average size of 141 bp. For this study, 11 extracts representing a range of sample quality were prepared from nonprobative forensic specimens. We demonstrate a significant increase in MPS amplification success when compared to testing methods using approximately 250 bp amplicons. Further, 16 of 17 independent amplifications previously "unreported" due to mixed sequences provided potentially reportable sequence data from a single, authentic template with MPS testing.

Bone and Bones↗
PubMed1996

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.

Animals↗
PubMed1994

Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein.

We have used baculovirus-expressed Rep68 that has been purified to homogeneity to reexamine the binding properties of the Rep protein. We find that Rep68 is capable of binding to a linear DNA sequence that is contained within a 25-bp sequence of the A stem of the adeno-associated virus (AAV) terminal repeat proximal to the B and C palindromes. This has been shown conclusively by demonstrating that Rep68 could specifically bind to a synthetic oligonucleotide containing the 25-bp region in the absence of the other sequences within the terminal repeat. Rep78 was also capable of binding the A stem recognition element, as demonstrated by the fact that a DNA affinity column containing the 25-bp sequence can be used to purify Rep78. The ability to recognize the linear DNA sequence within the A stem provides a mechanism by which the Rep protein can be oriented on the terminal repeat so that only the correct strand is cut at the terminal resolution site (trs site) during terminal resolution. In addition, computer analysis suggests that sequences similar to the A stem element are present within the three AAV promoter regions. Electrophoretic mobility shift experiments clearly demonstrate that the p5 promoter contains a Rep binding sequence. DNase protection experiments indicate that the Rep binding sequence within the p5 promoter is located between the YY1 initiator sequence and the TATA binding site. This position immediately suggests a mechanism by which the Rep protein could act as a repressor or a transactivator of p5 transcription by interacting with either YY1 or TBP. In addition, gel shift experiments suggest that the p19 promoter also contains a Rep binding site. The presence of Rep binding sites upstream of both promoters suggests that these sites may be involved in coordinate regulation of AAV transcription. In addition, we have identified a heterologous Rep binding sequence within pBR322 DNA. A comparison of the sequences within the A stem, p5, and pBR322 binding sites suggests that a repeating GAGC motif is at least part of the Rep recognition sequence. In the accompanying report (D. M. McCarty, J. H. Ryan, S. Zolutukhin, X. Zhou, and N. Muzyczka, J. Virol. 68:4998-5006, 1994), we examine the relative affinity of Rep to the A stem site and the complete terminal repeat. Finally, we also have reexamined the ability of Rep68 and Rep78 to cut at the trs site in substrates that do not contain the B and C palindromes or any apparent secondary structure.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1994

Interaction of the adeno-associated virus Rep protein with a sequence within the A palindrome of the viral terminal repeat.

We have characterized a Rep binding sequence which is within the A stem region of the adeno-associated virus terminal repeat (TR) and compared its affinity with that of the complete hairpinned TR for pure Rep68. Both the A stem and the complete TR substrates produced a complex pattern of protein-DNA complexes in which at least six different bound species could be distinguished. Competition experiments suggested that the dissociation constant for the A stem sequence is approximately 125-fold higher than that for the complete TR. The competition experiments also suggested that the average number of Rep molecules per TR substrate molecule under conditions of saturating substrate is 3.7:1, while for the A stem substrate, the ratio is 10:1. In spite of the apparent difference in protein-to-DNA ratio in the complexes, no major difference was seen in the mobility or the pattern of the protein-DNA complexes with the two kinds of substrates, suggesting that the difference in protein-to-DNA ratio was due to the lower stability of the A stem complex rather than the actual number of Rep molecules per DNA molecule. At least some of the difference in stability of the two kinds of complexes was due to the fact that the dissociation rate of the A stem substrate from the protein-DNA complexes was approximately fourfold faster than that of the complete TR. The dissociation rate curves for both substrates, however, were complex, suggesting that substrate was being released from at least two different kinds of protein-DNA complexes at different rates. In addition, we have analyzed binding to several substitution mutants within the A stem of the TR. A five-base mutant near the terminal resolution site (trs site) had little effect on binding. Two other mutants produced seven- or five-base substitutions within the 25-bp sequence of the A stem that had been identified in the accompanying report (D. M. McCarty, D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka, J. Virol. 68:4988-4997, 1994) as essential for binding. Each of these mutants eliminated some but not all of the repeating GAGC motifs in the 25-bp A stem region. Both of these mutants completely abolished binding to the A stem substrate but only partially reduced binding in the context of the complete hairpinned TR. Furthermore, neither mutant altered the pattern of Rep-DNA complexes produced.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1984

Ego identity status, conformity behavior, and personality in late adolescence.

Three related studies were completed to test the predictive relation among identity status, personality, and conformity behavior. The investigations were undertaken to replicate the earlier research findings of Toder and Marcia (1973). As predicted in Study 1, personality differences were found for both sexes. However, no relation was observed between identity status and conformity on the Asch task. Study 2 was completed to confirm the reliability of the identity status measure. Finally, in Study 3 four measures of conformity behavior (peer assessments, an experimental task, two self-report scales) were completed by college students of diffusion, foreclosure, moratorium, and identity-achievement statuses. Diffusion students were most influenced by peer pressure conformity, whereas identity-achievement students were most likely to report engaging in conformity behavior for achievement gains. Although earlier research by Toder and Marcia (1973) was not replicated via the Asch conformity task, the third study does support a predicted relation between identity and conformity behavior.

Adolescent↗