Biomedical subjects

J H van Boom

Publications and source records attributed to J H van Boom.

At least 109 records · Page 6Linked to original sources

PubMed1991

Interaction between the left-handed Z-DNA and polyamine. The crystal structure of the d(CG)3 and N-(2-aminoethyl)-1,4-diamino-butane complex.

The DNA fragment d(CG)3 was co-crystallized with N-(2-aminoethyl)-1,4-diaminobutane (PA(24], a chemically synthesized polyamine. The complex crystal contained one polyamine, 3 magnesium cations and one sodium cation per duplex of d(CG)3, and well diffracted the X-ray intensities up to 1.0 A resolution. The d(CG)3 took a left-handed Z-DNA conformation, and the PA(24) molecule electrostatically interacted with the phosphate groups of the d(CG)3 duplex.

Crystallization↗

PubMed1991

Solution structure of an oncogenic DNA duplex containing a G.A mismatch.

The DNA duplex 5'-d(GCCACAAGCTC).d(GAGCTGGTGGC), which contains a central G.A mismatch has been studied by one and two-dimensional NMR techniques. The duplex corresponds to the sequence 29-39 of the K-ras gene. The mismatch position is that of the first base of the Gly12 codon, a hot spot for mutations. The observed NOEs of the nonexchangeable protons show that both of the bases of the mismatched pair are intrahelical over a wide range of pH. However, the structure of the G.A mispair and the conformation of the central part of the duplex change with pH. This structural change shows a pK of 6.0. At low pH, the G.A bases are base paired with hydrogen bonds between the keto group of the G residue and the amino group of the A residue and, secondly, between the N7 of the G and a proton on N1 of A. This causes the G residue to adopt a syn conformation. On raising the pH, the N1-H proton of the protonated A residue is removed, and the base pair rearranges. In the neutral G.A base pair both residues adopt an anti conformation, and the mismatch is stabilized by hydrogen bonds. Our results on the exchangeable and A(H2) protons of the mismatched pair indicate a shift from a classical face-to-face two hydrogen-bonded structure to a slipped structure stabilized by bifurcated hydrogen bonds. This may be a particular characteristics of this oncogenic sequence in which the G.A error is poorly repaired.

Base Composition↗

PubMed1991

Facile formation of a crosslinked adduct between DNA and the daunorubicin derivative MAR70 mediated by formaldehyde: molecular structure of the MAR70-d(CGTnACG) covalent adduct.

MAR70 is a synthetic derivative of the anticancer drug daunorubicin that contains an additional sugar, attached to the O4' of daunosamine. When MAR70 was crystallized with the DNA hexamer d(CGTnACG), where nA is 2-aminoadenine, a covalent methylene bridge was formed between the N3' of daunosamine and the N2 of 2-aminoadenine. This spontaneous reaction occurred through the crosslinking action of formaldehyde. The crosslink was demonstrated by the three-dimensional structure of the 2:1 adduct between MAR70 and d(CGTnACG) solved at 1.3-A resolution by x-ray diffraction analysis. The perfect juxtaposition of the two amino groups in the complex provides a template for efficient addition of formaldehyde. This adduct structure is compared with the analogous structure at 1.5-A resolution of the complex of MAR70-d(CGTACG), in which no formaldehyde addition was observed. In both complexes, two MAR70 molecules bind to the DNA hexamer double helix; the elongated aglycon chromophore is intercalated between the CpG steps and spans the G.C Watson-Crick base pairs. The disaccharides occupy nearly the entire minor groove of the distorted B-DNA hexamer double helix. The second sugar is in contact with the sugar-phosphate backbone and does not affect the binding interactions of the daunorubicin portion to DNA. The structure allows us to model the binding to DNA of drugs having more extensive oligosaccharides. In addition, it suggests that placing a reactive (e.g., alkylating) functional group at the N3' amino position of daunorubicin might be a fruitful route for designing anticancer drugs.

Antineoplastic Agents↗

PubMed1991

Structure determination of a DNA octamer in solution by NMR spectroscopy. Effect of fast local motions.

NMR structures of biomolecules are primarily based on nuclear Overhauser effects (NOEs) between protons. For the interpretation of NOEs in terms of distances, usually the assumption of a single rotational correlation time corresponding to a rigid molecule approximation is made. Here we investigate the effect of fast internal motions of the interproton vectors in the context of the relaxation matrix approach for structure determination of biomolecules. From molecular dynamics simulations generalized order parameters were calculated for the DNA octamer d(GCGTTCGC).d(CGCAACGC), and these were used in the calculation of NOE intensities. The magnitudes of the order parameters showed some variation for the different types of interproton vectors. The lowest values were observed for the interresidue base H6/H8-H2" proton vectors (S2 = 0.60), while the cytosine H5-H6 interproton vectors were among the most motionally restricted (S2 = 0.92). Inclusion of the motion of the interproton vectors resulted in a much better agreement between theoretically calculated NOE spectra and the experimental spectra measured by 2D NOE spectroscopy. The interproton distances changed only slightly, with a maximum of 10%; nevertheless, the changes were significant and resulted in constraints that were better satisfied. The structure of the DNA octamer was determined by using restrained molecular dynamics simulations with H2O as a solvent, with and without the inclusion of local internal motions. Starting from A- or B-DNA, the structures showed a high local convergence (0.86 A), while the global convergence for the octamer was ca. 2.6 A.

Base Sequence↗

PubMed1991

Crystallization of complexes of EcoRV endonuclease with cognate and non-cognate DNA fragments.

Complexes of the type II restriction endonuclease EcoRV with a variety of short, selfcomplementary deoxyoligonucleotides have been crystallized. The best crystals diffract to about 2.7 A resolution and consist of 1:1 complexes between endonuclease dimers and duplexes of the cognate decamer GGGATATCCC containing the hexameric RV recognition sequence GATATC. Crystals with the non-cognate DNA octamer duplexes CGAGCTCG and CGAATTCG diffract to 3.0 and 3.5 A resolution, respectively, and contain two DNA duplexes per enzyme dimer.

Base Sequence↗

PubMed1991

A novel N-myristylated synthetic octapeptide inhibits protein kinase C activity and partially reverses murine fibrosarcoma cell resistance to adriamycin.

This report shows that N-acylation of the protein kinase C (PKC) substrate Arg-Lys-Arg-Thr-Leu-Arg-Arg-Leu (RKRTLRRL) provides it with a potent inhibitory activity against PKC. N-myristoyl-RKRTLRRL inhibited Ca2(+)- and phosphatidylserine (PS)-dependent histone phosphorylation catalyzed by PKC with a 50% inhibitory concentration (IC50) of 5 microM, whereas neither RKRTLRRL nor myristic acid inhibited PKC-catalyzed histone phosphorylation at concentrations as high as 50 microM. A fully active, Ca2(+)- and PS-independent catalytic fragment of PKC can be generated by limited proteolysis. N-myristoyl-RKRTLRRL inhibited histone phosphorylation catalyzed by the catalytic fragment of PKC (IC50 = 80 microM), but neither myristic acid nor the nonmyristylated peptide inhibited the activity of the catalytic fragment at concentrations up to and including 200 microM. The Km app and Vmax app for N-myristoyl-RKRTLRRL were similar to those of RKRTLRRL. Thus, N-myristylation provided the octapeptide with an inhibitory activity against PKC but had only minor effects on its Km app and Vmax app. Kinetic analysis provided evidence that the peptide inhibited PKC noncompetitively with respect to ATP. Previously, we reported that the protein kinase inhibitor H7 partially reverses Adriamycin resistance in the multidrug resistant (MDR) murine fibrosarcoma line UV-2237M-ADRR. In this report, we show that N-myristoyl-RKRTLRRL also partially reverses Adriamycin resistance in UV-2237M-ADRR cells. These results suggest that potent and selective cell permeable PKC inhibitors may be designed by N-acylating small PKC peptide substrates.

Amino Acid Sequence↗

PubMed1991

Photo-CIDNP study of the interaction between the glucocorticoid receptor DNA-binding domain and glucocorticoid response elements.

Photo-CIDNP studies were performed on two protein fragments that both contain the double zinc-finger DNA-binding domain of the glucocorticoid receptor. In the absence of DNA, Tyr452 and Tyr474 are polarised in both fragments while Tyr497 is not. Addition of a palindromic glucocorticoid response element (GRE) results in the suppression of Tyr474 polarization while the polarization of Tyr452 is unaffected. The same result is observed upon adding a half GRE to the protein fragment indicating that the suppression of Tyr474 polarization is not due to protein-protein contacts but to interaction with DNA.

Amino Acid Sequence↗

PubMed1991

Guanine-06 methylation reduces the reactivity of d(GpG) towards platinum complexes.

6-methylated guanine dinucleotides were used to study the influence of hydrogen bonding on the specific binding of the antitumor drug cDDP, cis-PtCl2(NH3)2, to DNA. In this interaction, the guanine-06 site appears to be important in explaining the preference for a pGpG-N7(1),N7(2) chelate, which results from H-bridge formation with the ammine ligand of cDDP. Guanine-06 methylated dinucleotides and the nonmodified dinucleotides were reacted with [Pt(dien)Cl]+, cis-PtCl2(NH3)2, and cis-[Pt(NH3)2(H2O)2]2+ and the reaction products were characterized by 1H NMR using pH titrations. Methylation at guanine-06 clearly reduces the preference for the guanine. In competition experiments monitored by NMR and experiments using UV spectrophotometry a decreasing reactivity towards [Pt(dien)(H2O)]2+ and cis-[Pt(NH3)2(H2O)2]2+ was found, in the order of d(GpG) greater than d(GomepG) greater than d(GpGome) greater than d(GomepGome). The difference in reactivity between 5' guanine methylation and 3' guanine methylation is ascribed to differences in the H-bond formation with the backbone phosphate. The resulting reduced stacking of the bases in both modified dinucleotides, compared to the bases in d(GpG), results in a preference for the 3' guanine over 5'.

Binding, Competitive↗

PubMed1991

Water-soluble cholesteryl-containing phosphorothioate monogalactosides: synthesis, properties, and use in lowering blood cholesterol by directing plasma lipoproteins to the liver.

The synthesis of several monogalactoside-terminated phosphorothiolated cholesteryl derivatives is described. Monogalactosyl derivatives are coupled by phosphorothiolation to cholesterol by using ethylene glycol units as hydrophilic spacer moieties. The resulting compounds are easily soluble in water. Upon addition of such solutions to human serum (to 2 mM final concentration) the compounds are readily incorporated into lipoproteins. Isolated low-density lipoprotein (LDL) and high-density lipoprotein (HDL), preloaded with the compounds, are rapidly cleared from the circulation by the liver. The hepatic association is blocked by N-acetylgalactosamine, which indicates that galactose-specific recognition sites are responsible for the increased liver uptake. The plasma clearance and hepatic uptake of LDL loaded with the compounds is substantially higher (about 2-fold) than clearance and uptake of HDL containing the compounds. The selectivity of the effects of monogalactoside-terminated phosphorothiolated cholesteryl derivatives on the in vivo behavior of LDL as compared to that of HDL indicates that these compounds might be used to lower specifically LDL levels in patients with a high LDL-cholesterol level.

Anticholesteremic Agents↗

PubMed1990

Solid-phase synthesis of H-Phe-Tyr-(pATAT)-NH2: a nucleopeptide fragment from the nucleoprotein of bacteriophage phi X174.

The preparation of the nucleopeptide H-Phe-Tyr-(pATAT)-NH2 could be realized via a solid phase phosphitetriester approach and by using the protected protecting group 2-(tert-butyldiphenylsilyoxymethyl)-benzoyl for the masking of the N6-amino function of deoxyadenosine. The latter protecting group can be removed under mild conditions with fluoride ion.

Bacteriophage phi X 174↗

PubMed1990

Structure of 11-deoxydaunomycin bound to DNA containing a phosphorothioate.

The anthracyclines form an important family of cancer chemotherapeutic agents with a strong dependence of clinical properties on minor differences in chemical structure. We describe the X-ray crystallographic solution of the three-dimensional structure of the anthracycline 11-deoxydaunomycin plus d(CGTsACG). In this complex, two drug molecules bind to each hexamer duplex. Both the drug and the DNA are covalently modified in this complex in contrast with the three previously reported DNA-anthracycline complexes. In the 11-deoxydaunomycin complex the 11 hydroxyl group is absent and a phosphate oxygen at the TpA step has been replaced by a sulfur atom leading to a phosphorothioate with absolute stereochemistry R. Surprisingly, removal of a hydroxyl group from the 11 position does not alter the relative orientation of the intercalated chromophore. However, it appears that the phosphorothioate modification influenced the crystallization and caused the 11-deoxydaunomycin-d(CGTsACG) complex to crystallize into a different lattice (space group P2) with different lattice contacts and packing forces than the non-phosphorothioated DNA-anthracycline complexes (space group P4(1)2(1)2). In the minor groove of the DNA, the unexpected position of the amino-sugar of 11-deoxydaunomycin supports the hypothesis that in solution the position of the amino sugar is dynamic.

DNA↗

PubMed1990

Biochemical and biophysical studies on the folding of the core region of the origin of replication of bacteriophage M13.

DNA oligonucleotides with the sequence corresponding to the plus strand origin of replication of the filamentous bacteriophage M13 are studied. Biochemical structure probing and UV melting studies, supplemented with initial NMR experiments, are used to investigate structural features of a 51-nucleotides long synthetic oligonucleotide and two oligonucleotides that are integral parts of this latter molecule. The results demonstrate the feasibility and complementarity of the use of methidiumpropyl.EDTA-Fe(II) and nuclease S1 in the structural analysis of small oligonucleotides. The bacteriophage origin region appears to comprise two hairpins. The first hairpin, which contains a cleavage site for the bacteriophage gene II protein, has a large and probably flexible loop. NMR as well as UV melting studies demonstrate that the second hairpin contains a stable three-membered loop. Both hairpins are present in the 51-mer, which forms a stable tertiary structure.

Bacteriophages↗

PubMed1990

NMR studies on the binding of antitumor drug nogalamycin to DNA hexamer d(CGTACG).

The interactions between a novel antitumor drug nogalamycin with the self-complementary DNA hexamer d(CGTACG) have been studied by 500 MHz two dimensional proton nuclear magnetic resonance spectroscopy. When two nogalamycins are mixed with the DNA hexamer duplex in a 2:1 ratio, a symmetrical complex is formed. All non-exchangeable proton resonances (except H5' & H5") of this complex have been assigned using 2D-COSY and 2D-NOESY methods at pH 7.0. The observed NOE cross peaks are fully consistent with the 1.3 A resolution x-ray crystal structure (Liaw et al., Biochemistry 28, 9913-9918, 1989) in which the elongated aglycone chromophore is intercalated between the CpG steps at both ends of the helix. The aglycone chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. The binding conformation suggests that specific hydrogen bonds exist in the complex between the drug and guanine-cytosine bases in both grooves of the helix. When only one drug per DNA duplex is present in solution, there are three molecular species (free DNA, 1:1 complex and 2:1 complex) in slow exchange on the NMR time scale. This equilibrium is temperature dependent. At high temperature the free DNA hexamer duplex and the 1:1 complex are completely destabilized such that at 65 degrees C only free single-stranded DNA and the 2:1 complex co-exist. At 35 degrees C the equilibrium between free DNA and the 1:1 complex is relatively fast, while that between the 1:1 complex and the 2:1 complex is slow. This may be rationalized by the fact that the binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through. A separate study of the 2:1 complex at low pH showed that the terminal GC base pair is destabilized.

Base Sequence↗

PubMed1990

Use of shuttle vectors to study the molecular processing of defined carcinogen-induced DNA damage: mutagenicity of single O4-ethylthymine adducts in HeLa cells.

We developed a simian virus 40 based shuttle vector system to study the molecular consequences of distinct carcinogen-induced DNA lesions in human cells. To establish the mutagenicity of O4-ethylthymine adducts, oligonucleotides carrying a single O4-ethylthymine adduct at a unique position were ligated into the vector molecules. Following replication in HeLa cells on average 23% of the progeny molecules carried a mutation in the region of modification. The vast majority of these mutations represented single T----C transitions at the position of the modified base, most probably as a consequence of mispairing of the O4-ethylthymine residues during replication. To a minor extent the O4-ethylthymine adduct may also induce T----A transversions or double point mutations. The in vivo mutation frequency of the adduct was found to be comparable to that of a C-A mismatch at the same position, but was lower than that expected from in vitro experiments with adducted DNA templates and purified DNA polymerases.

Base Sequence↗

PubMed1990

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Base Sequence↗

PubMed1990

Cyclic diguanylic acid behaves as a host molecule for planar intercalators.

Cyclic ribodiguanylic acid, c-(GpGp), is the endogenous effector regulator of cellulose synthase. Its three-dimensional structure from two different crystal forms (tetragonal and trigonal) has been determined by X-ray diffraction analysis at 1 A resolution. In both crystal forms, two independent c-(GpGp) molecules associate with each other to form a self-intercalated dimer. A hydrated cobalt ion is found to coordinate to two N7 atoms of adjacent guanines, forcing these two guanines to destack with a large dihedral angle (32 degrees), in the dimer of the tetragonal form. This metal coordination mechanism may be relevant to that of the anticancer drug cisplatin. Moreover, c-(GpGp) exhibits unusual spectral properties not seen in any other cyclic dinucleotide. It interacts with planar organic intercalator molecules in ways similar to double helical DNA. We propose a cage-like model consisting of a tetrameric c-(GpGp) aggregate in which a large cavity ('host') is generated to afford a binding site for certain planar intercalators ('guests').

Cyclic GMP↗

PubMed1990

Structural comparison of anticancer drug-DNA complexes: adriamycin and daunomycin.

The anticancer drugs adriamycin and daunomycin have each been crystallized with the DNA sequence d(CGATCG) and the three-dimensional structures of the complexes solved at 1.7- and 1.5-A resolution, respectively. These antitumor drugs have significantly different clinical properties, yet they differ chemically by only the additional hydroxyl at C14 of adriamycin. In these complexes the chromophore is intercalated at the CpG steps at either end of the DNA helix with the amino sugar extended into the minor groove. Solution of the structure of daunomycin bound to d(CGATCG) has made it possible to compare it with the previously reported structure of daunomycin bound to d(CGTACG). Although the two daunomycin complexes are similar, there is an interesting sequence dependence of the binding of the amino sugar to the A-T base pair outside the intercalation site. The complex of daunomycin with d(CGATCG) has tighter binding than the complex with d(CGTACG), leading us to infer a sequence preference in the binding of this anthracycline drug. The structures of daunomycin and adriamycin with d(CGATCG) are very similar. However, there are additional solvent interactions with the adriamycin C14 hydroxyl linking it to the DNA. Surprisingly, under the influence of the altered solvation, there is considerable difference in the conformation of spermine in these two complexes. The observed changes in the overall structures of the ternary complexes amplify the small chemical differences between these two antibiotics and provide a possible explanation for the significantly different clinical activities of these important drugs.

Amino Sugars↗

PubMed1990

Inhibition of UDP-glucuronosyltransferase activity by possible transition-state analogues in rat-liver microsomes.

A series of possible transition state analogues of the glucuronidation reaction catalyzed by UDP-glucuronosyltransferase were tested for their inhibitory effect on glucuronidation of various substrates in a rat liver microsomal fraction. In general 4-nitrophenol glucuronidation was more effectively inhibited than that of 1-naphthol, bilirubin or testosterone. 2-(1-Naphthyl)ethyl-UDP and 2,2,2-(triphenyl)ethyl-UDP were the most effective inhibitors. Their inhibitory effect was competitive towards both UDP-glucuronic acid and 4-nitrophenol. These compounds were much more effective inhibitors than UDP; therefore addition of a lipophilic group enhances the inhibitory potency of UDP. The various UDP derivatives showed differences in their abilities to inhibit the glucuronidation of the four acceptor substrates, supporting the concept that the different forms of UDP-glucuronosyl transferase have different active sites.

Animals↗