Biomedical subjects

J H van Boom

Publications and source records attributed to J H van Boom.

At least 145 records · Page 8Linked to original sources

PubMed1989

H NMR study of a complex between the lac repressor headpiece and a 22 base pair symmetric lac operator.

A complex between the lac repressor headpiece and a fully symmetric tight-binding 22 bp lac operator was studied by 2D NMR. Several 2D NOE spectra were recorded for the complex in both H2O and 2H2O. Many NOE cross-peaks between the headpiece and DNA could be identified, and changes in the chemical shift of the DNA protons upon complex formation were analyzed. Comparison of these data with those obtained for a complex between the headpiece and a 14 bp half-operator, studied previously [Boelens, R., Scheek, R. M., Lamerichs, R. M. J. N., de Vlieg, J., van Boom, J. H., & Kaptein, R. (1987) in DNA-ligand interactions (Guschlbauer, W., & Saenger, W., Eds.) pp 191-215, Plenum, New York], shows that two headpieces form a specific complex with the 22 bp lac operator in which each headpiece binds in the same way as found for the 14 bp complex. The orientation of the recognition helix in the major groove of DNA in these complexes is opposite with respect to the dyad axis to that found for other repressors.

Base Composition↗

PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗

PubMed1989

Effect of the G.T mismatch on backbone and sugar conformations of Z-DNA and B-DNA: analysis by Raman spectroscopy of crystal and solution structures of d(CGCGTG) and d(CGCGCG).

The Z-DNA crystal structures of d(CGCGTG) and d(CGCGCG) are compared by laser Raman spectroscopy. Raman bands originating from vibrations of the phosphodiester groups and sensitive to the DNA backbone conformation are similar for the two structures, indicating no significant perturbation to the Z-DNA backbone as a result of the incorporation of G.T mismatches. Both Z structures also exhibit Raman markers at 625 and 670 cm-1, assigned respectively to C3'-endo/syn-dG (internal) and C2'-endo/syn-dG conformers (3' terminus). Additional Raman intensity near 620 and 670 cm-1 in the spectrum of the d(CGCGTG) crystal is assigned to C4'-exo/syn-dG conformers at the mismatch sites (penultimate from the 5' terminus). A Raman band at 1680 cm-1, detected only in the d(CGCGTG) crystal, is assigned to the hydrogen-bonded dT residues and is proposed as a definitive marker of the Z-DNA wobble G.T pair. For aqueous solutions, the Raman spectra of d(CGCGTG) and d(CGCGCG) are those of B-DNA, but with significant differences between them. For example, the usual B-form marker band at 832 cm-1 in the spectrum of d(CGCGTG) is about 40% less intense than the corresponding band in the spectrum of d(CGCGCG), and the former structure exhibits a companion band at 864 cm-1 not observed for d(CGCGCG). The simplest interpretation of these results is that the conventional B-form OPO geometry occurs for only 6 of the 10 OPO groups of d(CGCGTG). The remaining four OPO groups, believed to be those at or near the mismatch site, are in an "unusual B" conformation which generates the 864 cm-1 band.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Composition↗

PubMed1989

Molecular structure of the netropsin-d(CGCGATATCGCG) complex: DNA conformation in an alternating AT segment.

The molecular structure of the complex between a minor groove binding drug (netropsin) and the DNA dodecamer d(CGCGATATCGCG) has been solved and refined by single-crystal X-ray diffraction analysis to a final R factor of 20.0% to 2.4-A resolution. The crystal is similar to that of the other related dodecamers with unit cell dimensions of a = 25.48 A, b = 41.26 A, and c = 66.88 A in the space group P2(1)2(1)2(1). In the complex, netropsin binds to the central ATAT tetranucleotide segment in the narrow minor groove of the dodecamer B-DNA double helix as expected. However, in the structural refinement the drug is found to fit the electron density in two orientations equally well, suggesting the disordered model. This agrees with the results from solution studies (chemical footprinting and NMR) of the interactions between minor groove binding drugs (e.g., netropsin and distamycin A) and DNA. The stabilizing forces between drug and DNA are provided by a combination of ionic, van der Waals, and hydrogen-bonding interactions. No bifurcated hydrogen bond is found between netropsin and DNA in this complex due to the unique dispositions of the hydrogen-bond acceptors (N3 of adenine and O2 of thymine) on the floor of the DNA minor groove. Two of the four AT base pairs in the ATAT stretch have low propeller twist angles, even though the DNA has a narrow minor groove. Alternating helical twist angles are observed in the ATAT stretch with lower twist in the ApT steps than in the TpA step.

Base Composition↗

PubMed1989

Thermodynamics of the various forms of the dodecamer d(ATTACCGGTAAT) and of its constituent hexamers from proton nmr chemical shifts and UV melting curves: three-state and four-state thermodynamic models.

Chemical shifts of base and H1' protons of the single-stranded hexamers d(ATTACC) and d(GGTAAT), of the 1:1 mixtures of these complementary hexamers, and of the self-complementary dodecamer d(ATTACCGGTAAT) were measured at various temperatures in aqueous solution. Four different sample concentrations were used in the case of the dodecamer and of the mixture of the complementary hexamers; the individual hexamers were measured at two different DNA concentrations. Absorbance temperature profiles at five different NaCl concentrations were measured for the dodecamer in order to quantify the effect of the ionic strength on the duplex formation. Under suitable conditions of nucleotide concentration, temperature, and ionic strength, the dodecamer adopts either a B-DNA duplex or a hairpin-loop structure. Chemical shift vs temperature profiles, constructed for all samples, were used to obtain thermodynamic parameters either for the various stacking interactions in the single strands or for the duplex or the hairpin-loop formation. In the analysis of the duplex formation of the hexamers, a two-state approach appeared too simple, because systematic deviations were revealed. Therefore, a new three-state model (DUPSTAK) was developed. In order to investigate the magnitude of error arising from the use of the two-state approach in cases where the DUPSTAK model appears more appropriate, a series of test calculations was made. The magnitude of error in the enthalpy and in the entropy of duplex melting is found to depend linearly upon the actual melting temperature and not upon the individual delta Hd degrees and delta Sd degrees values. Thermodynamic analysis of the chemical shift vs temperature profiles in D2O solution (no added salt) yields an average Tmd value of 341 K (1M DNA) and delta Hd degrees of - 121 kJ.mol-1 for the dimer/random-coil transition of the hexamer duplex d(ATTACC).d(GGTAAT). For the duplex in equilibrium random-coil transition of the 12-mer d(ATTACCGGTAAT) an average Tmd value of 336 K (1M DNA) and delta Hd degrees of -372 kJ.mol-1 are found. The hairpin/random-coil transition of d(ATTACCGGTAAT) is characterized by a rather large delta Hh degrees value, -130 kJ.mol-1, and an average Tmh value of 304 K.

Magnetic Resonance Spectroscopy↗

PubMed1989

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Base Composition↗

PubMed1989

Polyamine interaction with Z-DNA.

In order to elucidate the detailed Z-DNA interaction with polyamines and also to clarify the mutual molecular recognition between the left-handed helix and the biologically important polyamine molecule, several polyamine-Z-DNA hexamer complexes were crystallized and their crystal structures were determined by X-ray diffraction. The general interaction modes found in these crystal structures were discussed in comparison with those in the complexes between polyamine and the right-handed DNA or RNA.

Crystallization↗

PubMed1989

Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex.

The bisintercalation complex present between the DNA octamer [d(ACGTACGT)]2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C.G and A.T base pairs. At low temperatures, the A.T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A.T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degrees C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed.

Base Composition↗

PubMed1989

The left-handed Z-DNA conformation in oligodeoxynucleotides containing different amounts of AT base pairs: a far UV circular dichroism study.

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

Adenine↗

PubMed1989

Interactions between a symmetrical minor groove binding compound and DNA oligonucleotides: 1H and 19F NMR studies.

High-resolution NMR techniques (proton and 19F) have been used to study the interactions between several DNA oligonucleotides with varying length of AT base pairs and the synthetic pyrrole-containing compound (P1-F4S-P1), which has properties similar to the DNA minor groove binding drug distamycin A. When this two-fold symmetrical DNA binding molecule is added to the self-complementary DNA oligomers, the resulting complex exhibits an NMR spectrum without any doubling of individual resonances, consistent with a two-fold symmetry of the complex. This is in contrast to all other complexes studied so far. The minimum length of an AT stretch for specific ligand binding is judged to be greater than 4 base pairs. Inter-molecular proton nuclear Overhauser effects between the ligand molecule and a DNA dodecamer d(CGCAAATTTGCG) provide evidence that P1-F4S-P1 binds DNA in the minor groove and interacts with the middle AT base pairs. The presence of a specific interaction between P1-F4S-P1 and DNA is conclusively demonstrated by 19F NMR studies, in which four previously chemically equivalent fluorine nuclei in the free molecule become two non-equivalent pairs (yielding an AB quartet pattern) upon the binding of P1-F4S-P1 to DNA duplex. A sequence-dependent binding behavior of P1-F4S-P1 is evident by comparing the 19F NMR spectra of the complexes between P1-F4S-P1 and two different but related DNA dodecamers, d(CGCAAATTTGCG) and d(CGCTTTAAAGCG). P1-F4S-P1 binds more strongly to the former dodecamer with an association constant of approximately 1 X 10(3) M-1.

Base Sequence↗

PubMed1989

Synthesis of a substrate of protein kinase C and its corresponding phosphopeptide.

The syntheses of a protein kinase C (PKC) peptide substrate, H-Lys-Arg-Thr-Leu-Arg-OH, and a phosphopeptide analog of the synthetic substrate, H-Lys-Arg-Thr(P)-Leu-Arg-OH, are reported. PKC phosphorylates the peptide with an apparent KM of 0.30 +/- 0.04 mM and an apparent Vmax equal to one-tenth that of histone III-S. The synthesis of the phosphopeptide features a recently developed convenient phosphorylation procedure for serine and threonine using N,N-diethylamino-dibenzylphosphoramidite. A complete characterization of the PKC substrate and its corresponding phosphopeptide by C-H COSY 2D n.m.r. is included.

Chemical Phenomena↗

PubMed1988

Methylation of the EcoRI recognition site does not alter DNA conformation: the crystal structure of d(CGCGAm6ATTCGCG) at 2.0-A resolution.

Methylation of nucleic acid bases is known to prevent the cleavage of DNA by restriction endonucleases. The effect on the conformation of the DNA molecule itself and hence its interactions with other DNA binding proteins has been a subject of general interest. To help address this question, we have solved the crystal structure at 2.0 A of the methylated dodecamer, d(CGCGAm6ATTCGCG), which contains the EcoRI recognition sequence and have compared the conformation of the methylated molecule with that of its nonmethylated counterpart. This methylation produces a bulky hydrophobic patch on the floor of the major groove of B-DNA which plays an important role in the mechanism of inhibition of EcoRI restriction activity. However, with the exception of small perturbations in the immediate vicinity of the methyl groups, the structure is virtually unchanged. Given the lack of a conformational change upon methylation, we have extended this thesis of the recognition process to other types of restriction systems and found that different restriction enzymes seem to have their own characteristic protein-DNA interactions. The relative spatial orientations of methylation sites and cleavage sites must play a major role in ordering protein secondary structure elements as well as subunit-subunit interactions along the DNA strand.

Base Composition↗

PubMed1988

Molecular structure of cyclic deoxydiadenylic acid at atomic resolution.

The molecular structure of a small cyclic nucleotide, cyclic deoxydiadenylic acid, has been determined by single-crystal X-ray diffraction analysis and refined to an R factor of 7.8% at 1.0-A resolution. The crystals are in the monoclinic space group C2 with unit cell dimensions of a = 24.511 (3) A, b = 24.785 (3) A, c = 13.743 (3) A, and beta = 94.02 (2) degrees. The structure was solved by the direct methods program SHELXS-86. There are 2 independent cyclic d(ApAp) molecules, 2 hydrated magnesium ions, and 26 water molecules in the asymmetric unit of the unit cell. The two cyclic d(ApAp) molecules have similar conformations within their 12-membered sugar-phosphate backbone ring, but they have quite different appearances due to the different glycosyl torsion angles that make one molecule more compact and the other extended and open. Three of the four deoxyribose rings are in the less common C3'-endo conformation. All four phosphate groups have their phosphodiester torsion angles alpha/zeta in the gauche(+)/gauche(+) conformation. One of the cyclic d(ApAp) molecules associates with another symmetry-related molecule to form a self-intercalated dimer that is a stable structure in solution, as observed in NMR studies. Many interesting intermolecular interactions, including base-base stacking, ribose-base stacking, base pairing, base-phosphate hydrogen bonding, and metal ion-phosphate interactions, are found in the crystal lattice. This structure may be relevant for understanding the conformational potentiality of an endogenous biological regulator of cellulose synthesis, cyclic (GpGp).

Cyclic AMP↗

PubMed1988

Solution structure of the 3'-5' cyclic dinucleotide d(pApA). A combined NMR, UV melting, and molecular mechanics study.

The 3'-5' cyclic dinucleotide d(pApA) was studied by means of 1H and 13C NMR experiments, UV-melting experiments, and molecular mechanics calculations. The 1H and 13C NMR spectra were analyzed by means of 2-dimensional NMR experiments. J-Coupling analysis of the 1D and 2D 1H and 13C spectra was used to determine the conformation of the ring systems in the molecule. It appeared that at low temperature (283 K) the deoxyribose sugars adopt a N-type conformation. The geometry is best described by an intermediate between the 3(2)T and 3E forms. In addition, we were able to derive all other torsion angles in the phosphate backbone ring system, i.e., alpha +, beta t, gamma +, delta (= 89 degrees), epsilon t, and zeta +. When the molecule is subjected to an energy minimization procedure (using the program AMBER), the sugar ring system retains, practically speaking, the torsion angles found from the NMR experiments, while the torsion angles around the glycosidic bond adopt a value of 175 degrees in the minimum energy conformation. UV-melting experiments indicate that two molecules can form a dimer in which the adenine bases are intercalated. The feasibility of this structure is indicated by molecular mechanics calculations. At higher temperatures the dimer is converted into separate monomers. In the monomer form the sugars exhibit S-pucker 20% of the time. Concomitantly with the conversion of the N- to the S-conformation, the torsion angles alpha and gamma change.

Cyclic AMP↗

PubMed1988

Oligodeoxynucleotide folding in solution: loop size and stability of B-hairpins.

The secondary structures of the synthetic DNA fragments d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT) were investigated in a combined electrophoretic and spectroscopic study. All the oligomers exist, at low temperature and over a wide range of ionic strength (0.5-100 mM salt) and of nucleotide concentration [0.1-2.0 mM (phosphate)], as a mixture of two slowly interconverting species, identified as the dimeric duplex and the monomeric hairpin structure. The thermodynamic parameters for hairpin denaturation of T5, A5, TA, and AT and for duplex denaturation of d(CGCGCG) show that (a) the hairpins are more stable than the reference hexamer duplex at all accessible nucleotide concentrations; (b) the loop contributes favorably to the enthalpy change of hairpin denaturation in the four DNA fragments; (c) the base composition of the loop (A vs T) and the size of the loop (A5/T5 vs TA/AT) do not appreciably influence the enthalpic contents of the hairpins; (d) hairpins TA and AT, with two AT bases intervening in the CG self-complementary part of the molecule, exhibit a markedly higher thermal stability than hairpins T5 and A5, which is entropic in origin. These findings are consistent with the presence of two-residue loops in the tetradecamers TA and AT.

Base Composition↗

PubMed1988

The B-Z conformational transition in folded oligodeoxynucleotides: loop size and stability of Z-hairpins.

The capacity to assume a left-handed conformation and the thermodynamics of loop formation in concentrated aqueous NaClO4 have been investigated for the following palindromic sequences: d-(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT). The results show that (a) each oligomer assumes a Z conformation upon exposure to increasing NaClO4 concentrations; the salt concentration at the transition midpoint is 1.8 M for both A5 and T5 and 3 and 3.5 M for TA and AT, respectively; (b) in high salt the four oligomers exist, over a wide range of nucleotide concentrations (up to 10(-3) M) and of temperature (greater than 0 degrees C), as unimolecular hairpin structures; (c) hairpins TA and AT exhibit, in buffer A, a lower thermal stability with respect to A5 and T5 (delta T about 16 degrees C), contrary to what is observed at low ionic strength; (d) on hairpin formation, the enthalpic term is about -52 kcal/mol for the two 17-mers and -38 kcal/mol for the two 14-mers, while the change in entropy is found to be around -150 eu for A5 and T5 and -115 eu for TA and AT. This thermodynamic picture suggests that a two-residue loop for TA and AT, found at low ionic strength [see preceding paper (Xodo, L.E., Manzini, G., Quadrifoglio, F., van der Marel, G.A., & van Boom, J.H. (1988) Biochemistry (preceding paper in this issue)], is substituted by a longer one including two additional residues from a missing dC.dG base pairing at the top of the stem.

Base Sequence↗

PubMed1988

Synthesis of nucleic acid methylphosphonothioates.

The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine.

Chemical Phenomena↗

PubMed1988

Bulge-out structures in the single-stranded trimer AUA and in the duplex (CUGGUGCGG).(CCGCCCAG). A model-building and NMR study.

Model-building studies were carried out on the trimer AUA. Bulge-out structures which allow incorporation into a continuous RNA helix were generated and energy-minimized. All geometrical features obtained by previous NMR studies on purine-pyrimidine-purine sequences are accounted for in these models. One of the models was used to fit into a double helical fragment. Only minor changes were necessary to construct a central bulge-out in an otherwise intact duplex. NMR and model-building studies were performed on the duplex (CUGGUGCGG).(CCGCCCAG) which contains an unpaired uridine residue. NOE data, chemical-shift profiles and imino-proton resonances provided evidence that the extra U is bulged out of the duplex. The relatively small dispersion in 31P chemical shifts (approximately equal to 0.7 ppm) indicate the absence of t/g or g/t combinations for the phosphodiester angles zeta/alpha. An energy-minimized model of the duplex, which fits the present collection of data, is presented.

Base Composition↗