PubMed Health⌕ Search

Biomedical subjects

J J Hutton

Publications and source records attributed to J J Hutton.

At least 19 recordsLinked to original sources
PubMed1998

Sustaining the development of primary care in academic medicine. Working Group on Sustaining the Development of Academic Primary Care. Association of American Medical Colleges.

This article is the report of the Working Group on Sustaining the Development of Academic Primary Care, one of the six subgroups of the Advisory Panel on the Mission and Organization of Medical Schools (APMOMS) sponsored by the Association of American Medical Colleges (AAMC). To begin, the group draws a distinction between primary care and generalism. Primary care is a core domain of health care and, in the context of emerging integrated systems, will increasingly be a multidisciplinary shared function. Non-subspecialized physicians, or "generalists," are a key element in the provision of primary care, but do not act alone. Core competencies for primary care are central to the education of all physicians. Therefore, irrespective of workforce goals for generalist physicians, primary care should have a strong, central position in the medical school so that graduates can receive a sound general medical education and can be prepared for any specialty and for lifelong learning in an evolving health care system. For primary care to achieve that position, medical schools must integrate primary care into their missions, strategic plans, operation, organization, academic administrative structures, curriculum development, faculty development (both school- and community-based), resource development, alliances with appropriate clinical services networks, financial policy, and evaluation and educational monitoring systems. The group briefly describes the elements of those changes and also proposes ways that the AAMC and medical school leaders could promote the central role of primary care in medical schools.

Curriculum↗
PubMed1996

Preserving medical schools' academic mission in a competitive marketplace.

To gain a better understanding of the effects on medical schools of transformations in medical practice, science, and public expectations, the AAMC in 1994 formed the Advisory Panel on the Mission and Organization of Medical Schools and appointed six working groups to address relevant issues. This article is a report of the findings of the Working Group on Preserving Medical Schools' Academic Mission in a Competitive Marketplace, which was charged with exploring how medical schools could acquire and/or preserve an adequate patient base for teaching, research, and income generation in a competitive marketplace. The other groups' reports will appear in future issues of Academic Medicine. To understand the diversity of approaches that schools have taken to achieve this goal and to preserve their missions, the group interviewed representatives of nine medical schools, selected to represent a cross section of U.S. medical schools. The interviews took place on four occasions between June 1995 and March 1996. The information and comments shared by participants helped the working group gain insight into the fundamental issues it had been charged to address, including those of new delivery structures, what value schools offer to delivery structures, how education and research can be incorporated and supported financially, possible new pressures on relationships between medical schools and teaching hospitals, changes in faculty physicians' employment relationships and terms, and the role of the medical school in graduate medical education. In collecting and analyzing the data, the working group focused on the distinction between protecting an institution's existing enterprise and preserving an institution's core mission. This article gives a detailed overview of the information and comments each school presented, organized under the appropriate question. The working group's conclusions and commentaries on the findings follow. An appendix presents more detailed summaries of the schools' presentations, organised as case studies. The picture that emerges is complex. The working group concluded that medical schools will take a variety of approaches to define and preserve their missions. Most, but not all, medical schools will be able to secure the patient bases necessary to fulfill their missions even in a competitive marketplace. However, the nature of many of the schools is likely to change, and it is not clear whether the core missions of education and research will continue at their present levels at all schools.

Costs and Cost Analysis↗
PubMed1995

A central role for a single c-Myb binding site in a thymic locus control region.

Locus control regions (LCRs) are powerful assemblies of cis elements that organize the actions of cell-type-specific trans-acting factors. A 2.3-kb LCR in the human adenosine deaminase (ADA) gene first intron, which controls expression in thymocytes, is composed of a 200-bp enhancer domain and extended flanking sequences that facilitate activation from within chromatin. Prior analyses have demonstrated that the enhancer contains a 28-bp core region and local adjacent augmentative cis elements. We now show that the core contains a single critical c-Myb binding site. In both transiently cotransfected human cells and stable chromatin-integrated yeast cells, c-Myb strongly transactivated reporter constructs that contained polymerized core sequences. c-Myb protein was strongly evident in T lymphoblasts in which the enhancer was active and was localized within discrete nuclear structures. Fetal murine thymus exhibited a striking concordance of endogenous c-myb expression with that of mouse ADA and human ADA LCR-directed transgene expression. Point mutation of the c-Myb site within the intact 2.3-kb LCR severely attenuated enhancer activity in transfections and LCR activity in transgenic thymocytes. Within the context of a complex enhancer and LCR, c-Myb can act as an organizer of thymocyte-specific gene expression via a single binding site.

Adenosine Deaminase↗
PubMed1995

Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences.

Using transgenic mice, we have defined novel gene regulatory elements, termed "facilitators." These elements bilaterally flank, by up to 1 kb, a 200-bp T-cell-specific enhancer domain in the human adenosine deaminase (ADA) gene. Facilitators were essential for gene copy-proportional and integration site-independent reporter expression in transgenic thymocytes, but they had no effect on the enhancer in transfected T cells. Both segments were required. Individual segments had no activity. A lack of facilitator function caused positional susceptibility and prevented DNase I-hypersensitive site formation at the enhancer. The segments were required to be at opposed ends of the enhancer, and they could not be grouped together. Reversing the orientation of a facilitator segment caused a partial loss of function, suggesting involvement of a stereospecific chromatin structure. trans-acting factor access to enhancer elements was modeled by exposing nuclei to a restriction endonuclease. The enhancer domain was accessible to the 4-cutter DpnII in a tissue- and cell-type-specific fashion. However, unlike DNase I hypersensitivity and gene expression, accessibility to the endonuclease could occur without the facilitator segments, suggesting that an accessible chromatin domain is an intermediate state in the activational pathway. These results suggest that facilitators (i) are distinct from yet positionally constrained to the enhancer, (ii) participate in a chromatin structure transition that is necessary for the DNase I hypersensitivity and the transcriptional activating function of the enhancer, and (iii) act after cell-type-specific accessibility to the enhancer sequences is established by factors that do not require the facilitators to be present.

Adenosine Deaminase↗
PubMed1992

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine Deaminase↗
PubMed1991

Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts.

Using histochemical detection, we have visualized in situ the complete metabolic pathway for the degradation of purine nucleotides. From the tongue to the ileum, diverse epithelial cell types lining the lumen of the mouse gastrointestinal (GI) tract strongly coexpress each of the five key purine catabolic enzymes. Dramatic increases in the expression of each enzyme occurred during postnatal maturation of the GI tract. Using in situ hybridization, an intense accumulation of adenosine deaminase (ADA) mRNA was detected only within GI epithelial cells undergoing postmitotic differentiation. In a similar manner, at the developing maternal-fetal interface, high level expression of the purine catabolic pathway also occurred in a unique subset of maternal decidual cells previously known to express high levels of alkaline phosphatase and ADA. This induction occurred almost immediately after implantation in the periembryonic maternal decidual cells, shortly thereafter in antimesometrial decidual cells, and later in cells of the placental decidua basalis: all of which contain cell types thought to be undergoing programmed cell death. The expression of the pathway at the site of embryo implantation appears to be critical because its pharmacologic inhibition during pregnancy has been found to be embryolethal or teratogenic. Purine destruction at these nutritional interfaces (placenta and gastrointestinal tract) seem to override any potential economy of purine salvage, and may represent biochemical adaptation to nucleic acid breakdown occurring in the context of dietary digestion or extensive programmed cell death.

5'-Nucleotidase↗
PubMed1989

Cell type-specific transcriptional regulation of the human adenosine deaminase gene.

The relative rates of transcription of the human adenosine deaminase (ADA) gene were determined in isolated nuclei from T and B lymphoblasts and skin fibroblasts. ADA gene transcription occurs at higher rates in T cells than in B cells and fibroblasts. Relative steady state ADA mRNA levels were also determined for each cell line, and these values were found to correlate with relative rates of transcription of the gene. Therefore, the primary mechanism for control of expression of this ubiquitous enzyme is at the level of transcription. The ratios of ADA enzymatic activity to specific mRNA content were also compared between cell lines. The B lymphoblasts exhibited lower ratios than did the T lymphoblasts, suggesting that rates of protein degradation were several fold greater in B than in T lymphoblast cell lines. This finding is consistent with previous direct measurements of ADA protein turnover. Differential rates of protein turnover in B as compared to T cells provide a secondary mechanism for the regulation of ADA expression. In addition to transcription initiation being the major control mechanism of steady state ADA mRNA in all cell lines, first intron elongation pausing occurs in fibroblasts, and discrete regions of RNA polymerase II and RNA polymerase III antisense transcripts are observed in all cell lines studied.

Adenosine Deaminase↗
PubMed1989

Normal and mutant human adenosine deaminase genes.

Adenosine deaminase (ADA) deficiency in humans is one cause of severe combined immunodeficiency. When ADA fails to catalyze the deamination of adenosine and deoxyadenosine, the levels of deoxyadenosine that accumulate are toxic to lymphoid cells. Patients with complete ADA deficiency (e.g., with less than 5% normal ADA catalytic activity) lack both B- and T-lymphocyte function. B-lymphoblast cell lines derived from patients with ADA deficiency have been analyzed at multiple levels. Blot hybridization and S1 nuclease analysis of ADA messenger RNA (mRNA) indicates that the majority of ADA-deficient cell lines have ADA mRNA in the same abundance and size as in normal cell lines. Sequence analysis of ADA cDNAs derived from these mRNAs shows that the majority of mutations are single base changes that alter the amino acid sequence. Expression analysis proves that these point mutations lead to deficiency of ADA catalytic activity. Several cell lines have mutations that alter mRNA transcription or processing. These include a point mutation in one allele of an ADA-deficient cell line that leads to deletion of exon 4 during mRNA splicing. In addition, two cell lines are homozygous for large deletions of the gene that are the result of homologous recombination. Subjects with partial ADA deficiency have undetectable ADA activity in their erythrocytes, variable activity in their lymphoid cells, and normal immunological function. Analysis of the ADA catalytic activity of partially deficient cell lines indicates that the mutations involved affect protein stability. However, the mutations causing partial ADA deficiency are as yet undefined.

Adenosine Deaminase↗
PubMed1988

Mutant human adenosine deaminase alleles and their expression by transfection into fibroblasts.

Adenosine deaminase (ADA) deficiency in humans is one cause of severe combined immunodeficiency disease. Single base mutations affecting the ADA protein have been identified for both alleles of the ADA-deficient cell line GM2606 and for one allele of the ADA-deficient cell line GM2825A. One allele of GM2606 has a mutation altering amino acid 101 from Arg to Trp, and the other allele has a mutation altering amino acid 211 from Arg to His. As previously reported, one ADA allele of GM2825A has a single base mutation changing Ala-329 to Val-329, and the other allele has a mutation which eliminates exon 4 from the mature mRNA. Sequence analysis of polymerase chain reaction-amplified GM2825A DNA showed a single base change of A to G within the invariant bases of the 3' splice site of intron 3 that can account for the mis-splicing of exon 4. To test the effect on ADA catalytic activity of these mutations and the mutations previously found in the ADA-deficient line GM2756, expression vectors containing normal and mutant ADA-coding sequences under transcriptional regulation of the Rous sarcoma virus long terminal repeat were constructed and transfected into human fibroblasts. All transfected cells had levels of ADA mRNA 15-25 times higher than the endogenous ADA message. Yet, cells transfected with the normal ADA-coding sequences had ADA enzymatic levels 40 times higher than cells transfected with any of the mutant ADA sequences. This analysis demonstrates that while the mutant ADA-coding sequences are transcribed, they do not encode a functional ADA protein.

Adenosine Deaminase↗
PubMed1988

Chromosomal organization of the cytochrome P450-2C gene family in the mouse: a locus associated with constitutive aryl hydrocarbon hydroxylase.

Cytochromes P-450 represent a superfamily of enzymes with a central role in the metabolism of drugs, chemical toxins, and carcinogens. We have used genetic analysis to establish the complexity and catalytic function of a recently identified constitutively expressed murine hepatic cytochrome P-450 encoded by P450-2C. Southern blotting analysis shows that there are at least seven or eight genes within this family in the mouse and rat and that DNA restriction fragment length variants between different mouse inbred strains are observed. Analysis of recombinant inbred strains derived from these parent strains shows (i) these genes are clustered within 1 centimorgan, (ii) this gene family does not correspond to any of the known cytochrome P-450 loci or map near any well-characterized genomic markers, and (iii) this gene family segregates to within 1-2 centimorgans of a locus controlling constitutive aryl hydrocarbon hydroxylase activity in mice. With use of Chinese hamster/mouse somatic cell hybrids, the P450-2C locus was assigned to a region of mouse chromosome 19 that appears to be syntenic with the previously mapped human P450C2C locus on human chromosome 10. By in situ hybridization to mitotic mouse chromosomes, we have localized this region to the tip of chromosome 19. These results are discussed in relation to the physiological roles of this P-450 family in foreign compound metabolism and steroid oxidations.

Animals↗
PubMed1988

Phase II study of fludarabine phosphate (NSC-312887) in patients with advanced ovarian cancer. A Southwest Oncology Group Study.

Fourteen evaluable patients with advanced ovarian cancer refractory to one prior chemotherapy regimen were treated with a 5-day schedule of fludarabine phosphate. No responses were noted. The major toxicity was granulocytopenia with 50% of patients having granulocyte counts of less than 1,000/microliter. Based on this study and one other previously published trial, fludarabine phosphate does not appear to be an active agent for patients with refractory ovarian cancer.

Adult↗
PubMed1988

Adenosine deaminase (ADA) deficiency due to deletion of the ADA gene promoter and first exon by homologous recombination between two Alu elements.

In 15-20% of children with severe combined immunodeficiency (SCID), the underlying defect is adenosine deaminase (ADA) deficiency. The goal of this study was to determine the precise molecular defect in a patient with ADA-deficient SCID whom we previously have shown to have a total absence of ADA mRNA and a structural alteration of the ADA gene. By detailed Southern analysis, we now have determined that the structural alteration is a deletion of approximately 3.3 kb, which included exon 1 and the promoter region of the ADA gene. DNA sequence analysis demonstrates that the deletion created a novel, complete Alu repeat by homologous recombination between two existing Alu repeats that flanked the deletion. The 26-bp recombination joint in the Alu sequence includes the 10-bp "B" sequence homologous to the RNA polymerase III promoter. This is the first example of homologous recombination involving the B sequence in Alu repeats. Similar recombination events have been identified involving Alu repeats in which the recombination joint was located between the A and B sequences of the polymerase III split promoter. The nonrandom location of these events suggests that these segments may be hot spots for recombination.

Adenosine Deaminase↗
PubMed1988

Fludarabine monophosphate: a potentially useful agent in chronic lymphocytic leukemia.

Recent developments in experimental chemotherapy may benefit patients with chronic lymphocytic leukemia (CLL). Fludarabine monophosphate has shown promise in heavily pretreated patients with advanced CLL. The Southwest Oncology Group has recently completed a phase II investigation of fludarabine in 32 patients. The patient population had a median age of 63 years, median performance status of 1, and included patients with the following stages of the disease: stage 0-3 patients; stage I-5 patients; stage II-6 patients; stage III-4 patients; stage IV-14 patients. A total of 176 courses were administered. Myelosuppression was the most frequent toxicity observed with 13 patients having a decline in platelets, and 11 patients having some decline in granulocytes. Fludarabine monophosphate has had unequivocal antileukemic activity in a group of patients with advanced CLL.

Adult↗
PubMed1987

Identification of a deletion in the adenosine deaminase gene in a child with severe combined immunodeficiency.

A patient with adenosine deaminase-deficient severe combined immunodeficiency is described whose defect is secondary to deletion of a portion of the ADA structural gene. In Southern analyses, DNA from this patient does not hybridize to a genomic probe that includes the 3' end of exon 1. This implies that both his parents are heterozygous for deletions of exon 1 sequences. Consistent with this finding, the patient has no detectable adenosine deaminase mRNA by Northern analysis. This is the first report of a deletion mutation as the cause of adenosine deaminase deficiency.

Adenosine Deaminase↗
PubMed1987

Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing.

Adenosine deaminase (ADA; adenosine aminohydrolase, EC 3.5.4.4) deficiency is one cause of the genetic disease severe combined immunodeficiency. To identify mutations responsible for ADA deficiency, we synthesized cDNAs to ADA mRNAs from two cell lines, GM2756 and GM2825A, derived from ADA-deficient immunodeficient patients. Sequence analysis of GM2756 cDNA clones revealed a different point mutation in each allele that causes amino acid changes of alanine to valine and arginine to histidine. One allele of GM2825A also has a point mutation that causes an alanine to valine substitution. The other allele of GM2825A was found to produce an mRNA in which exon 4 had been spliced out but had no other detrimental mutations. S1 nuclease mapping of GM2825A mRNAs showed equal abundance of the full-length ADA mRNA and the ADA mRNA that was missing exon 4. Several of the ADA cDNA clones extended 5' of the major initiation start site, indicating multiple start sites for ADA transcription. The point mutations in GM2756 and GM2825A and the absence of exon 4 in GM2825A appear to be directly responsible for the ADA deficiency. Comparison of a number of normal and mutant ADA cDNA sequences showed a number of changes in the third base of codons. These changes do not affect the amino acid sequence. Analyses of ADA cDNAs from different cell lines detected aberrant RNA species that either included intron 7 or excluded exon 7. Their presence is a result of aberrant splicing of pre-mRNAs and is not related to mutations that cause ADA deficiency.

Adenosine Deaminase↗