PubMed Health⌕ Search

Biomedical subjects

J Jonasson

Publications and source records attributed to J Jonasson.

At least 37 records · Page 2Linked to original sources
PubMed1995

Characterization of Haemophilus influenzae isolates from the respiratory tract of patients with primary antibody deficiencies: evidence for persistent colonizations.

A total of 117 consecutive patients with primary antibody deficiencies were followed for up to 5 years with regard to acute respiratory tract infections. Nontypeable Haemophilus influenzae (NTHI) was the sole pathogen in 61% (202/330) of the samples from which a potential pathogen was recovered. Common variable immunodeficiency (CVI) was the most prevalent condition (27/39 patients) in the group where H. influenzae was isolated. In patients where H. influenzae was not found only 9/78 patients had CVI. 49 of these 78 patients had isolated IgG3 or IgA deficiency. Both of these entities seemed to be associated with a lower prevalence of NTHI infections. 13 of 18 patients with at least 2 isolates of NTHI were colonized with the same strain from 3 to 43 months as shown by total genomic DNA-fingerprinting. Recurrent symptomatic infections occurred in these patients despite substitution therapy with gammaglobulins and repeated antibiotic treatments. All but 2 of the 224 H. influenzae isolates were beta-lactamase negative and sensitive to ampicillin. The use of 10 lipopolysaccharide-specific monoclonal antibodies in a whole cell ELISA showed that the LPS-epitopes on the 224 H. influenzae isolates from the hypogammaglobulinemic group were very similar to 499 NTHI isolates from immunocompetent patients with respiratory infections. One may therefore conclude that i) patients with CVI, were prone to be permanently colonized with NTHI, and ii) the colonizing bacteria were ordinary strains showing the same LPS-phenotypes as those strains that cause acute respiratory tract infections in immunocompetent individuals.

Adolescent↗
PubMed1994

Helicobacter pylori in a Costa Rican dyspeptic patient population.

Gastric biopsies from 65 Costa Rican dyspeptic patients were investigated for the presence of Helicobacter pylori DNA by polymerase chain reaction (PCR) amplification of 16S rRNA sequences. Both frozen and paraffin-embedded samples were used, and the results were compared with bacterial culture and histological examination. Helicobacter pylori DNA was detected by PCR in 60 (92%) of the patients, and Helicobacter pylori strains confirmed by PCR could be isolated from 37 of them. Altogether, 59 patients were shown to be infected using the combination of culture and histology as the reference method. The sensitivity of PCR analysis of frozen material was 98% (58/59). The PCR analysis of paraffin-embedded samples seemed less reliable than that of frozen biopsy material.

Adult↗
PubMed1994

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Adenoids↗
PubMed1988

A study of chromosomal aberrations in amniotic fluid cell cultures.

This paper represents the analysis of 1916 routine amniotic fluid specimens harvested by an in situ fixation technique in a prospective study with regard to cultural chromosome anomalies. Excluding constitutional abnormalities, 2.9 per cent of 19,432 cells analysed showed some form of chromosome anomaly, terminal deletions (57 per cent) and chromatid/chromosome breaks and gaps (18 per cent) being the most frequent, followed by interchange aberrations (13 per cent) and trisomy (5 per cent). No case was found of more than one colony from the same culture showing the same anomaly without it being present in other cultures from the same fluid. The wholly abnormal colonies had a surplus of trisomies and from the mathematical considerations presented one may infer that these are likely to reflect the presence of abnormal cells in the amniotic fluid. Partly abnormal colonies appeared at a frequency that would correspond to virtual absence of selection against chromosomally abnormal cells when cultured in vitro. The aberrations found were similar to those seen as single cell anomalies, except for chromatid breaks and exchanges. The data suggest a basic preferential induction of trisomy for chromosomes 2, 18, 21, and the Y-chromosome. Structural aberrations showed a marked clustering of breakpoints around the centromeres. The frequency of mutant cells was low (1.4 X 10(-3)) before culture was initiated. At harvest, the frequency of abnormal cells was much higher (3 X 10(-2)) corresponding to 3 X 10(-3) mutations per cell per generation accumulating over approximately ten generations in vitro.

Amniotic Fluid↗
PubMed1987

Trisomy 18 and maternal serum and amniotic fluid alpha-fetoprotein.

Maternal serum and amniotic fluid alpha-fetoprotein levels were studied retrospectively in a total of 58 pregnancies with trisomy 18. In those pregnancies uncomplicated by either fetal exomphalos or neural tube defect the midtrimester maternal serum alpha-fetoprotein (MSAFP) levels were markedly reduced, the median value for 38 such pregnancies being 0.6 multiples of the median (MoM). Trisomy 18 with exomphalos was associated with a higher median MSAFP, but still within the normal range: 1.1 MoM, (nine pregnancies); trisomy 18 with exomphalos and neural tube defect (NTD) was associated with grossly raised levels: median MSAFP was 4.5 MoM (three pregnancies). Amniotic fluid alpha-fetoprotein (AFAFP) levels were normal in uncomplicated trisomy 18 pregnancies: median AFAFP, for 19 pregnancies, was 1.1 MoM. Exomphalos alone, or together with neural tube defect, was associated with greatly elevated levels of AFAFP; for exomphalos alone median AFAFP was 9.59 MoM (four pregnancies), and for exomphalos with neural tube defect the median AFAFP was 23.95 Mom (three pregnancies). Screening with low and high MSAFP, routine ultrasound, and amniocentesis on all women aged 35 years or over, together might identify over 50 per cent of pregnancies with trisomy 18.

Adult↗
PubMed1985

An unusual case of X-15 translocation: evidence for the presence of an 'activator' region on Xpter of man.

A case of an X-autosome rearrangement is presented in which part of the Xpter is deleted but the STS and MIC2X loci are retained. The normal X is late replicating in 97/100 lymphocytes and 50/50 fibroblasts examined. It is assumed that the initial X-inactivation in the embryo is random, but that cells with the rearranged X inactivated are selected against because inactivation spreads into the attached autosomal segment. This spreading, through the normally active STS locus, is hypothesised to be caused by deletion of a part of Xpter which is critical for the maintenance of activity of the Xpter region as a whole.

Cells, Cultured↗
PubMed1982

Immunopathology of B-cell lymphomas induced in C57BL/6 mice by dualtropic murine leukemia virus (MuLV).

Combined clinicopathologic and immunomorphologic evidence is presented that would indicate that a murine leukemia virus (MuLV) with the dualtropic host range is capable of producing a clinically malignant lesion composed of immunoblasts and associated plasma cells in C57BL/6 mice. This process, morphologically diagnosed as an immunoblastic lymphoma of B cells using standard histopathologic criteria, was found to be distinctly polyclonal with regard to immunoglobulin (Ig) isotype when analyzed for both surface and cytoplasmic Ig. Further studies demonstrated that this clinicopathologically malignant, dualtropic MuLV-induced, polyclonal immunoblastic lymphoma of B cells in C57BL/6 mice was normal diploid and unable to be successfully transplanted to nonimmunosuppressed syngeneic recipients. Although all serum heavy and light chain components were found to be progressively elevated as the tumor load increased, the polyclonal increase in serum immunoglobulins was most pronounced for mu heavy and kappa light chains (ie, mu greater than gamma 2A greater than alpha greater than gamma 2B greater than gamma 1; kappa greater than lamba). The dissociation of clinicopathologic and biologic criteria for malignancy in the presently described dualtropic (RadLV) MuLV-induced B-cell lesion is sharply contrasted with the thymotropic (RadLV), MuLV-induced T-cell lymphoblastic lymphoma in C57BL/6 mice. This process is also a clinicopathologically malignant lesion but, when one uses biologic criteria, is found to be distinctly monoclonal, aneuploid, and easily transplanted to nonimmunosuppressed syngeneic recipients. The close clinicopathologic and biologic similarities of the dualtropic MuLV-induced animal model to corresponding human B-cell lymphoproliferative diseases are stressed.

Animals↗
PubMed1980

Analysis of sister-chromatid exchanges and tumorigenicity in cell hybrids.

The relationship between the 'spontaneous' frequency of sister-chromatid exchanges (SCE) and tumorigenicity was studied in a series of hybrids between a C57BL melanoma cell line and diploid cells, but no correlation was found between the 2 variables. Hybrids in which malignancy was suppressed and malignant segregants derived from them showed virtually identical SCE frequencies. Variation of SCE frequencies was observed, however, between the different hybrid clones, and most hybrids showed consistently less SCE per chromosome than the corresponding parental cell types did under similar growth conditions. The lower SCE frequencies could neither be related to a higher number of chromosomes in the hybrid nor could they be related to the method of hybrid selection. These findings suggest that cell fusion might have induced epigenetic SCE frequency changes possible in the same way as modulation of SCE frequencies is known to occur in the humam leukocyte series.

Animals↗
PubMed1977

Reduced adrenal amine synthesis in spontaneously hypertensive rats after long-term treatment with propranolol.

Male spontaneously hypertensive rats were either fed a diet containing 3 mg/g of (+/-)-propranolol, giving a mean daily intake of 178 +/- 4.2 mg/kg, or a control diet from 7 weeks of age for 6 months. Three days after cessation of propranolol-treatment, the arterial blood pressure of the treated group was about 10% lower than that of the control group. Adrenal dopamine content and tyrosine hydroxylase activity were reduced to 76% and 71% of the control values, respectively. The results indicate that propranolol causes a reduced sympathetic discharge through its central action, although blockade of beta-adrenoceptor-mediated local regulatory mechanisms cannot be excluded.

Adrenal Glands↗
PubMed1977

The analysis of malignancy by cell fusion. VIII. Evidence for the intervention of an extra-chromosomal element.

Diploid human fibroblasts and lymphocytes were fused with the cells of a malignant mouse melanoma and a range of hybrid clones selected for study. The ability of these clones to produce progressive tumours was assayed in nude mice. Although human chromosomes were preferentially eliminated in all the hybrid clones, the human diploid cells were as effective as mouse diploid cells in suppressing the malignancy of the mouse melanoma cells. The suppression produced by fibroblasts was again more profound than that produced by lymphocytes. Malignancy was also found to be suppressed in a hybrid clone in which a single X was the only human chromosome present; and this clone continued to give a very low take incidence even after the human X had been eliminated by back selection. Hybrids were made between the melanoma cells and diploid human fibroblasts that had been given 100 J kg-1 of gamma radiation before cell fusion. These hybrids contained no recognizable human chromosomes, but their ability to produce progressive tumours was greatly reduced compared to that of the melanoma parent cells. The take incidences given by the crosses between the melanoma cells and the irradiated human fibroblasts were, however, substantially higher than those given by the crosses between the melanoma cells and unirradiated fibroblasts. These findings suggest that the suppression of malignancy involves the activity of some extra-chromosomal element and that this element is radio-sensitive.

Animals↗
PubMed1977

Growth in vitro of tumour cell x fibroblast hybrids in which malignancy is suppressed.

We have studied the growth in vitro of a lymphoma x fibroblast hybrid and several melanoma x fibroblast hybrids in which malignancy is suppressed. The parental cells, the hybrids, and malignant segregants derived from the hybrids were analysed for serum requirement, cloning efficiency in soft agarose, density-dependent inhibition of growth, and secretion of plasminogen-activating enzyme. One malignant segregant from the lymphoma x fibroblast cross was found by a number of criteria to have a more highly 'transformed' phenotype than the hybrid from which it was derived. However, in the case of the melanoma x fibroblast crosses, none of the parameters examined could be correlated in a direct way with malignancy.

Clone Cells↗