PubMed Health⌕ Search

Biomedical subjects

J M Friedman

Publications and source records attributed to J M Friedman.

At least 19 recordsLinked to original sources
PubMed2007

Pregnancy and postnatal outcome of mosaic isochromosome 20q.

Prenatally diagnosed mosaicism for isochromosome 20q is generally reported in association with a normal outcome at birth and is rarely confirmed postnatally. However, the origin of these abnormal cells is unclear and there are few reports of long-term outcomes. We present an additional case of prenatally detected isochromosome 20q, with normal outcome up to age 3.6 years. The abnormal cells, while present at high levels in the amniotic fluid, could not be confirmed in placenta or fetal blood. Nonetheless, based on a review of the literature, the level of isochromosome 20q cells found is associated with risk of abnormal outcome, suggesting a possible effect in some cases.

Adult↗
PubMed2006

Trends and racial disparities in muscular dystrophy deaths in the United States, 1983-1998: an analysis of multiple cause mortality data.

To identify trends and patterns associated with muscular dystrophy (MD)-associated deaths, we analyzed population-based data from death certificates in the Multiple Cause Mortality Files compiled by the National Center for Health Statistics. From 1983 to 1998, 14,499 deaths in the United States were associated with ICD-9 codes for MD. The mortality rate for MD in the general U.S. population over this time period was 0.365 per 100,000 persons per year. Stratification by age at death revealed a trimodal distribution with peaks at 0, 17, and 62 years. The male-to-female ratio varied with age at death, a pattern consistent with a mixture of autosomal and X-linked MDs with different prognoses. Deaths related to MD appeared to be equally divided between presumed autosomal and X-linked MDs. The mortality rate was higher in Whites than in Blacks, for both autosomal and X-linked MDs. The median age at death was lower in Blacks than Whites for both males and females. Cardiac complications were more commonly noted among MD-associated deaths in Blacks (38.9%) than Whites (28.6%). Respiratory infections were noted in about 20% of MD-associated deaths and were more common in winter than summer months. Potential reasons for the racial differences include differences in prevalence rates, rates of diagnosis, and reporting on death certificates. Additional studies are needed to resolve these issues. Challenges in the interpretation of these data include the lack of ICD-9 codes specific for individual MDs and potential recording biases in underlying cause of death and contributing factors. We also present a method for estimating autosomal and X-linked contributions to the overall mortality rate of a genetically heterogeneous condition such as MD.

Adolescent↗
PubMed2006

Oligonucleotide microarray analysis of genomic imbalance in children with mental retardation.

The cause of mental retardation in one-third to one-half of all affected individuals is unknown. Microscopically detectable chromosomal abnormalities are the most frequently recognized cause, but gain or loss of chromosomal segments that are too small to be seen by conventional cytogenetic analysis has been found to be another important cause. Array-based methods offer a practical means of performing a high-resolution survey of the entire genome for submicroscopic copy-number variants. We studied 100 children with idiopathic mental retardation and normal results of standard chromosomal analysis, by use of whole-genome sampling analysis with Affymetrix GeneChip Human Mapping 100K arrays. We found de novo deletions as small as 178 kb in eight cases, de novo duplications as small as 1.1 Mb in two cases, and unsuspected mosaic trisomy 9 in another case. This technology can detect at least twice as many potentially pathogenic de novo copy-number variants as conventional cytogenetic analysis can in people with mental retardation.

Child↗
PubMed2006

Vitamin D deficiency associated with number of neurofibromas in neurofibromatosis 1.

Neurofibromatosis 1 (NF1) is a tumour suppressor gene syndrome characterized by multiple cutaneous and plexiform neurofibromas. Focal osseous abnormalities, short stature, and decreased bone mineral density are also frequent in people with NF1. We measured serum 25-hydroxyvitamin D concentrations in 55 patients with NF1 and 58 healthy controls, and correlated the findings in the patients with NF1 with their estimated number of dermal neurofibromas. Geometric mean (SD) serum 25-hydroxyvitamin D concentration was 14.0 (1.6) ng/mL among the patients with NF1 compared with 31.4 (1.7) ng/mL among healthy controls (p<<0.0001). The serum vitamin D concentration and number of dermal neurofibromas reported by patients with NF1 were inversely correlated (Spearman's rho = -0.572, p<0.00001). The occurrence of low serum vitamin D concentrations in people with NF1, especially those with many dermal neurofibromas, may provide new pathogenic insights and have important therapeutic implications.

Adult↗
PubMed2006

Improvement in stroke mortality in Canada and the United States, 1990 to 2002.

BACKGROUND: In the United States and Canada, folic acid fortification of enriched grain products was fully implemented by 1998. The resulting population-wide reduction in blood homocysteine concentrations might be expected to reduce stroke mortality if high homocysteine levels are an independent risk factor for stroke. METHODS AND RESULTS: In this population-based cohort study with quasi-experimental intervention, we used segmented log-linear regression to evaluate trends in stroke-related mortality before and after folic acid fortification in the United States and Canada and, as a comparison, during the same period in England and Wales, where fortification is not required. Average blood folate concentrations increased and homocysteine concentrations decreased in the United States after fortification. The ongoing decline in stroke mortality observed in the United States between 1990 and 1997 accelerated in 1998 to 2002 in nearly all population strata, with an overall change from -0.3% (95% CI, -0.7 to 0.08) to -2.9 (95% CI, -3.5 to -2.3) per year (P=0.0005). Sensitivity analyses indicate that changes in other major recognized risk factors are unlikely to account for the reduced number of stroke-related deaths in the United States. The fall in stroke mortality in Canada averaged -1.0% (95% CI, -1.4 to -0.6) per year from 1990 to 1997 and accelerated to -5.4% (95% CI, -6.0 to -4.7) per year in 1998 to 2002 (P< or =0.0001). In contrast, the decline in stroke mortality in England and Wales did not change significantly between 1990 and 2002. CONCLUSIONS: The improvement in stroke mortality observed after folic acid fortification in the United States and Canada but not in England and Wales is consistent with the hypothesis that folic acid fortification helps to reduce deaths from stroke.

Adult↗
PubMed2006

Increasing the specificity of diagnostic criteria for schwannomatosis.

Diagnostic criteria for schwannomatosis have been proposed in a recent consensus statement. These criteria permit schwannomatosis to be distinguished from neurofibromatosis type 2 (NF2) in most patients, but there is some clinical overlap between the two diseases. In this study, the authors use data from the population-based United Kingdom NF2 Registry to recommend modifications that increase the specificity of the schwannomatosis diagnostic criteria.

Adolescent↗
PubMed2006

Survival in infants with Down syndrome, Metropolitan Atlanta, 1979-1998.

OBJECTIVE: Factors influencing survival among persons with Down syndrome (DS) are not well understood. We sought to evaluate survival of infants with DS and potential prognostic factors. STUDY DESIGN: Infants with DS who were born alive during 1979 to 1998 were identified using the Metropolitan Atlanta Congenital Defects Program (MACDP), a population-based surveillance system. To document vital status, we used data from hospital records, the National Death Index (NDI), and Georgia vital records. We estimated survival probability using the Kaplan-Meier product limit method and hazard ratios using a Cox proportional hazards model. RESULTS: Survival probability to 1 year was 92.9% (95% CI: 90.9-94.9) and to 10 years was 88.6% (95% CI: 85.0-92.2). Univariate analysis demonstrated that black maternal race, low birth weight, preterm birth, lower paternal education, presence of heart defects, and presence of other major congenital anomalies were important prognostic factors. After multivariate analysis, maternal race, presence of heart defects, low birth weight, and an interaction between maternal race and presence of heart defects were significantly associated with mortality risk. CONCLUSIONS: A racial disparity is apparent in survival for children with Down syndrome. Further study is needed to elucidate possible reasons for the racial disparity.

Black or African American↗
PubMed2005

Submicroscopic deletions and duplications in individuals with intellectual disability detected by array-CGH.

Intellectual disability (ID) affects about 3% of the population (IQ < 70), and in about 40% of moderate (IQ 35-49) to severe ID (IQ < 34), and 70% of cases of mild ID (IQ 50-70), the etiology of the disease remains unknown. It has long been suspected that chromosomal gains and losses undetectable by routine cytogenetic analysis (i.e., less than 5-10 Mb in size) are implicated in ID of unknown etiology. Array CGH has recently been used to perform a genome-wide screen for submicroscopic gains and losses in individuals with a normal karyotype but with features suggestive of a chromosome abnormality. In two recent studies, the technique has demonstrated a approximately 15% detection rate for de novo copy number changes of individual clones or groups of clones. Here, we describe a study of 22 individuals with mild to moderate ID and nonsyndromic pattern of dysmorphic features suspicious of an underlying chromosome abnormality, using the 3 Mb and 1 Mb commercial arrays (Spectral Genomics). Deletions and duplications of 16 clones, previously described to show copy number variability in normal individuals [Iafrate et al., 2004; Lapierre et al., 2004; Schoumans et al., 2004; Vermeesch et al., 2005] were seen in 21/22 subjects and were considered polymorphisms. In addition, three subjects showed submicroscopic deletions and duplications not previously reported as normal variants. Two of these submicroscopic changes were of de novo origin (microdeletions at 7q36.3 and a microduplication at 11q12.3-13.1) and one was of unknown origin as parental testing of origin could not be performed (microduplication of Xp22.3). The clinical description of the three subjects with submicroscopic chromosomal changes at 7q36.3, 11q12.3-13.1, Xp22.3 is provided.

Chromosome Aberrations↗
PubMed2005

Analysis of NF1 transcriptional regulatory elements.

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.

5' Flanking Region↗
PubMed2005

Association between benign and malignant peripheral nerve sheath tumors in NF1.

OBJECTIVE: People with neurofibromatosis type 1 (NF1) have a 10% lifetime risk of developing a malignant peripheral nerve sheath tumor (MPNST). MPNSTs are often metastatic and are a frequent cause of death among people with NF1. Clinical evidence suggests that most MPNSTs in people with NF1 develop from preexisting plexiform neurofibromas. However, it is not known whether an individual's risk of developing an MPNST is associated with the burden of benign neurofibromas. The authors conducted a study to determine whether people with NF1 who have benign neurofibromas of various kinds are at greater risk of developing MPNSTs than patients with NF1 who lack these benign tumors. METHODS: Clinical information on 476 NF1 probands in the Henri Mondor Database was analyzed by logistic regression to examine associations between MPNSTs and internal plexiform, superficial plexiform, subcutaneous, and cutaneous neurofibromas. RESULTS: Individuals with subcutaneous neurofibromas were approximately three times more likely to have internal plexiform neurofibromas or MPNSTs than individuals without subcutaneous neurofibromas. Individuals with internal plexiform neurofibromas were 20 times more likely to have MPNSTs than individuals without internal plexiform neurofibromas. When this analysis was done with both subcutaneous and internal plexiform neurofibromas as explanatory variables, only the association of MPNSTs with internal plexiform neurofibromas remained significant. CONCLUSIONS: The observation that malignant peripheral nerve sheath tumors are strongly associated with internal plexiform neurofibromas suggests that patients with neurofibromatosis type 1 with these benign tumors warrant increased surveillance for malignancy.

Adolescent↗
PubMed2005

Diagnostic criteria for schwannomatosis.

The neurofibromatoses are a diverse group of genetic conditions that share a predisposition to the development of tumors of the nerve sheath. Schwannomatosis is a recently recognized third major form of neurofibromatosis (NF) that causes multiple schwannomas without vestibular tumors diagnostic of NF2. Patients with schwannomatosis represent 2.4 to 5% of all patients requiring schwannoma resection and approximately one third of patients with schwannomatosis have anatomically localized disease with tumors limited to a single limb or segment of spine. Epidemiologic studies suggest that schwannomatosis is as common as NF2, but that familial occurrence is inexplicably rare. Patients with schwannomatosis overwhelmingly present with pain, and pain remains the primary clinical problem and indication for surgery. Diagnostic criteria for schwannomatosis are needed for both clinicians and researchers, but final diagnostic certainly will await the identification of the schwannomatosis locus itself.

Diagnosis, Differential↗
PubMed2005

Angiotensin II receptor antagonist treatment during pregnancy.

Angiotensin II (A-II) is the main effector of the renin-angiotensin system. A-II functions by binding its type 1 (AT1) receptors to cause vasoconstriction and retention of sodium and fluid. Several AT1 receptor antagonists-a group of drugs collectively called "sartans"-have been marketed during the past few years for treatment of hypertension and heart failure. At least 15 case reports describe oligohydramnios, fetal growth retardation, pulmonary hypoplasia, limb contractures, and calvarial hypoplasia in various combinations in association with maternal losartan, candesartan, valsartan, or telmisartan treatment during the second or third trimester of pregnancy. Stillbirth or neonatal death is frequent in these reports, and surviving infants may exhibit renal damage. The fetal abnormalities, which are strikingly similar to those produced by maternal treatment with angiotensin-converting enzyme (ACE) inhibitors during the second and third trimesters of pregnancy, are probably related to extreme sensitivity of the fetus to the hypotensive action of these drugs. Very little information is available regarding the outcome of human pregnancies in which the mother was treated with an AT1 receptor antagonist during the first trimester, but animal studies have not demonstrated teratogenic effects after maternal treatment with large doses of AT1 receptor antagonists during organogenesis. We conclude that pharmacological suppression of the fetal renin-angiotensin system through ACE inhibition or AT1 receptor blockade seems to disrupt fetal vascular perfusion and renal function. We recommend that maternal treatment with AT1 receptor antagonists be avoided during the second and third trimesters of pregnancy and that women who become pregnant while taking one of these medications be changed to an antihypertensive drug of a different class as soon as the pregnancy is recognized.

Angiotensin II↗
PubMed2005

Is osseous dysplasia a primary feature of neurofibromatosis 1 (NF1)?

Characteristic skeletal lesions are a cardinal feature of the autosomal dominant condition, neurofibromatosis 1 (NF1). The most frequently involved skeletal sites are the sphenoid wing, vertebrae, and tibia. Osseous lesions may range in severity in NF1 but are often progressive. They may lead to serious clinical consequences and be resistant to treatment. The skeletal lesions of NF1 are usually considered to be 'dysplasias', i.e. primary defects of bone, although there is no direct evidence supporting this interpretation. Moreover, it is difficult to understand why a generalized dysplasia of bone would produce focal lesions that show such a striking predisposition to only a few bones. We review the clinical and pathological features of NF1 skeletal lesions and propose that they result from an abnormal response of NF1 halpoinsufficient bone to abnormal mechanical forces rather than from a primary osseous dysplasia.

Biomechanical Phenomena↗
PubMed2005

The location of constitutional neurofibromatosis 2 (NF2) splice site mutations is associated with the severity of NF2.

Neurofibromatosis 2 (NF2) patients with constitutional splice site NF2 mutations have greater variability in disease severity than NF2 patients with other types of mutations; the cause of this variability is unknown. We evaluated genotype-phenotype correlations, with particular focus on the location of splice site mutations, using mutation and clinical information on 831 patients from 528 NF2 families with identified constitutional NF2 mutations. The clinical characteristics examined were age at onset of symptoms of NF2 and number of intracranial meningiomas, which are the primary indices of the severity of NF2. Two regression models were used to analyse genotype-phenotype correlations. People with splice site mutations in exons 1-5 had more severe disease than those with splice site mutations in exons 11-15. This result is compatible with studies showing that exons 2 and 3 are required for self-association of the amino terminal of the NF2 protein in vitro, and that deletions of exons 2 and 3 in transgenic and knockout mouse models of NF2 cause a high prevalence of Schwann cell derived tumours.

Alternative Splicing↗
PubMed2004

Genotype-phenotype correlations for nervous system tumors in neurofibromatosis 2: a population-based study.

Neurofibromatosis 2 (NF2) is an autosomal dominant disease that is characterized by tumors on the vestibular branch of the VIII cranial nerve, but other types of nervous system tumors usually occur as well. Genotype-phenotype correlations are well documented for overall NF2 disease severity but have not been definitively evaluated for specific types of non-VIII nerve tumors. We evaluated genotype-phenotype correlations for various types of non-VIII nerve tumors in 406 patients from the population-based United Kingdom NF2 registry, using regression models with the additional covariates of current age and type of treatment center (specialty or nonspecialty). The models also permitted consideration of intrafamilial correlation. We found statistically significant genotype-phenotype correlations for intracranial meningiomas, spinal tumors, and peripheral nerve tumors. People with constitutional NF2 missense mutations, splice-site mutations, large deletions, or somatic mosaicism had significantly fewer tumors than did people with constitutional nonsense or frameshift NF2 mutations. In addition, there were significant intrafamilial correlations for intracranial meningiomas and spinal tumors, after adjustment for the type of constitutional NF2 mutation. The type of constitutional NF2 mutation is an important determinant of the number of NF2-associated intracranial meningiomas, spinal tumors, and peripheral nerve tumors.

Age of Onset↗
PubMed2004

Analysis of neurofibromatosis 1 (NF1) lesions by body segment.

Café-au-lait spots and neurofibromas are defining features of neurofibromatosis 1 (NF1), but they vary greatly in number, size, and clinical importance from patient to patient. The cause of this variability is unknown. We tested the hypotheses that development of these lesions is influenced by local or familial factors. The presence or absence of café-au-lait spots, cutaneous neurofibromas, and diffuse plexiform neurofibromas was recorded for each of 10 divisions of the body surface in 547 NF1 patients, including 117 affected individuals in 52 families. We used stratified Mantel-Haenszel tests to look for local associations between the presence of diffuse plexiform neurofibromas, cutaneous neurofibromas, and café-au-lait spots in individual body segments of NF1 patients. We used a random effects model to obtain intrafamilial correlation coefficients for the age-adjusted number of body divisions affected with each of the three lesions. No significant association was observed between the occurrence of cutaneous and diffuse plexiform neurofibromas, between café-au-lait spots and cutaneous neurofibromas, or between café-au-lait spots and plexiform neurofibromas in the same body segment. The correlation among relatives in the number of body segments affected with café-au-lait spots was 0.45 (95% confidence interval [CI] = 0.18-0.71), with cutaneous neurofibromas, 0.37 (95% CI = 0.15-0.55), and with plexiform neurofibromas, 0.35 (95% CI = 0.15-0.57). We conclude that the development of café-au-lait spots, cutaneous neurofibromas, and plexiform neurofibromas are spatially independent in NF1 patients but that the development of all three lesions is influenced by familial factors.

Adolescent↗