Biomedical subjects

J Mazella

Publications and source records attributed to J Mazella.

At least 37 records · Page 2Linked to original sources

PubMed1999

Pivotal role of an aspartate residue in sodium sensitivity and coupling to G proteins of neurotensin receptors.

The highly conserved aspartate residue in the second transmembrane domain of G protein-coupled receptors is present in position 113 in the type 1 neurotensin receptor (NTR1) but is replaced by an Ala residue in position 79 in the type 2 neurotensin receptor (NTR2). NTR1 couples to Galphaq to stimulate phospholipase C and its binding affinity for neurotensin is decreased by sodium ions and GTP analogs. By contrast, NTR2 does not seem to couple to any G protein in eukaryotic cells, and its binding of neurotensin is insensitive to sodium and GTP analogs. By using site-directed mutagenesis, we substituted Asp113 of the NTR1 by alanine and the homologous residue Ala79 of NTR2 by aspartate. Both mutant receptors display similar affinity for neurotensin as compared with their respective wild type. We demonstrate that the presence of the Asp residue determines by itself the occurrence of the sodium effect on neurotensin affinity for both wild-type and mutated NTR1 and -2. The introduction of an Asp in the second transmembrane domain of NTR2 is not enough to restore a functional coupling to G proteins. In contrast, replacement of Asp113 by Ala residue in NTR1 strongly decreases its ability to activate inositol turnover, indicating that the functionally active conformation of NTR1 is maintained by interaction of sodium ions with aspartate 113.

Amino Acid Sequence↗

PubMed1998

The 100-kDa neurotensin receptor is gp95/sortilin, a non-G-protein-coupled receptor.

In this work, the 100-kDa neurotensin (NT) receptor previously purified from human brain by affinity chromatography (Zsürger, N., Mazella, J., and Vincent, J. P. (1994) Brain Res. 639, 245-252) was cloned from a human brain cDNA library. This cDNA encodes a 833-amino acid protein 100% identical to the recently cloned gp95/sortilin and was then designated NT3 receptor-gp95/sortilin. The N terminus of the purified protein is identical to the sequence of the purified gp95/sortilin located immediately after the furin cleavage site. The binding of iodinated NT to 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid-solubilized extracts of COS-7 cells transfected with the cloned cDNA was saturable and reversible with an affinity of 10-15 nM. The localization of the NT3 receptor-gp95/sortilin into intracellular vesicles was in agreement with previous results obtained with the purified receptor and with gp95/sortilin. Affinity labeling and binding experiments showed that the 110-kDa NT3 receptor can be partly transformed into a higher affinity (Kd = 0.3 nM) 100-kDa protein receptor by cotransfection with furin. This 100-kDa NT receptor corresponded to the mature form of the receptor. The NT3/gp95/sortilin protein is the first transmembrane neuropeptide receptor that does not belong to the superfamily of G-protein-coupled receptors.

Adaptor Proteins, Vesicular Transport↗

PubMed1998

Mutagenesis and modeling of the neurotensin receptor NTR1. Identification of residues that are critical for binding SR 48692, a nonpeptide neurotensin antagonist.

The two neurotensin receptor subtypes known to date, NTR1 and NTR2, belong to the family of G-protein-coupled receptors with seven putative transmembrane domains (TM). SR 48692, a nonpeptide neurotensin antagonist, is selective for the NTR1. In the present study we attempted, through mutagenesis and computer-assisted modeling, to identify residues in the rat NTR1 that are involved in antagonist binding and to provide a tentative molecular model of the SR 48692 binding site. The seven putative TMs of the NTR1 were defined by sequence comparison and alignment of bovine rhodopsin and G-protein-coupled receptors. Thirty-five amino acid residues within or flanking the TMs were mutated to alanine. Additional mutations were performed for basic residues. The wild type and mutant receptors were expressed in COS M6 cells and tested for their ability to bind 125I-NT and [3H]SR 48692. A tridimensional model of the SR 48692 binding site was constructed using frog rhodopsin as a template. SR 48692 was docked into the receptor, taking into account the mutagenesis data for orienting the antagonist. The model shows that the antagonist binding pocket lies near the extracellular side of the transmembrane helices within the first two helical turns. The data identify one residue in TM 4, three in TM 6, and four in TM 7 that are involved in SR 48692 binding. Two of these residues, Arg327 in TM 6 and Tyr351 in TM 7, play a key role in antagonist/receptor interactions. The former appears to form an ionic link with the carboxylic group of SR 48692, as further supported by structure-activity studies using SR 48692 analogs. The data also show that the agonist and antagonist binding sites in the rNTR1 are different and help formulate hypotheses as to the structural basis for the selectivity of SR 48692 toward the NTR1 and NTR2.

Amino Acid Sequence↗

PubMed1998

Regional and cellular distribution of low affinity neurotensin receptor mRNA in adult and developing mouse brain.

Levocabastine-sensitive neurotensin receptor (NTRL) mRNAs were localized by in situ hybridization in adult and developing mouse brain. NTRL hybridization signal was widely distributed throughout the neuraxis. The highest concentrations of NTRL mRNA were detected in the olfactory system, olfactory tubercle, cerebral and cerebellar cortices, hippocampal formation, and selective hypothalamic nuclei. Moderate to dense hybridization signal was also observed in association with a variety of auditory, visual, and somatosensory relay nuclei, suggesting that the NTRL might be involved in a widespread modulation of primary afferent pathways. Finally a high expression of NTRL was evident in brainstem structures implicated in descending antinociceptive influences (e.g., the periaqueductal gray, nucleus raphe magnus, gigantocellular reticular nucleus, pars alpha, and lateral paragigantocellular nucleus) consistent with the proposed mediation of NT-induced analgesia by the NTRL. Although most of the regions found here to express NTRL mRNA were previously reported to be devoid of mRNA encoding the high affinity NT receptor (NTRH), a few areas (e.g., the anterior olfactory nucleus, medial septum, diagonal band of Broca, reticular thalamic nucleus, suprachiasmatic hypothalamic nucleus, and pontine nucleus) were enriched in both receptor subtypes, suggesting a possible coexpression of these receptors by the same cells. Ontogenic studies revealed that in the mouse brain, NTRL mRNA was detected only from postnatal day 14 and did not reach adulthood concentrations before day 30. In cerebral cortex, the developmental increase in NTRL expression was correlated over time with the decrease in NTRH expression previously documented in the rat, suggesting a progressive takeover of the latter by the former for transduction of the effects of NT in this structure.

Animals↗

PubMed1998

Stable expression of the mouse levocabastine-sensitive neurotensin receptor in HEK 293 cell line: binding properties, photoaffinity labeling, and internalization mechanism.

The recently cloned new subtype of G protein-coupled neurotensin receptor (NTRL) was stably expressed in the HEK 293 cell line in order to investigate its binding and internalization properties. The expressed receptor exhibited the typical binding characteristics of the low affinity, levocabastine-sensitive binding site previously described in rat and mouse brain and was detected as a protein with an apparent MW of 45 kDa by photoaffinity labeling. Although intracellular modulation of adenylate cyclase, guanylate cyclase and phospholipase C was not detected after application of neurotensin or levocabastine on NTRL-transfected cells, this receptor was able to internalize iodinated neurotensin. The internalization process was followed by recycling of receptors to the cell membrane. By contrast, no recycling was observed with the high affinity neurotensin receptor (NTRH). The differential intracellular routing of NTRH and NTRL after internalization is most probably the consequence of their divergent carboxy-terminal sequences.

Amino Acid Sequence↗

PubMed1998

Preferential expression of sst2A over sst2B somatostatin receptor splice variant in rat brain and pituitary.

The expression of sst2A and sst2B somatostatin (SRIH) receptor splice variants was examined by polymerase chain reaction (PCR) in rat brain and pituitary. Two sets of primers chosen to recognize either both sst2A and sst2B or only the sst2B transcript yielded bands of the size predicted from the cloned sst2A and sst2B sequences in both mouse and rat tissue extracts. Accordingly, experiments carried out on mouse brain extracts and on AtT-20 pituitary cells yielded sst2A/sst2B expression ratios comparable to those previously published. As in the mouse, rat pituitary extracts contained both sst2A and sst2B transcripts. By contrast, various cerebral regions in which both sst2A and sst2B forms were detected in the mouse contained only sst2A form in rat brain, with the exception of the cerebral cortex which also showed weak sst2B expression. No sst2B mRNA was detected in the arcuate nucleus/median eminence complex, indicating that the sst2A form is the one that is associated with growth-hormone-releasing-hormone-containing neurons documented to express sst2 receptors in this region. Finally, only sst2A transcripts were detected in rat astrocytes in culture, suggesting that this form of the receptor is responsible for sst2-mediated effects of SRIH on these cells.

Animals↗

PubMed1997

Differentiation-dependent and cell-specific regulation of the hIGFBP-1 gene in human endometrium.

We analyzed IGFBP-1 gene promoter activity by transient transfection during the progressive decidualization of human endometrial stromal cells. A time study over a 13-day culture period showed that the promoter activity increased exponentially to > 10(4) fold in cells treated with MPA and RLX correlating with the secretion rate and steady-state mRNA levels of the endogenous gene. Deletion analysis showed that two regions in the IGFBP-1 gene promoter are responsible for the activation of the IGFBP-1 gene. The basal promoter region between -1 and -300 bp contains multiple sections of functional elements homologous either to CRE, PRE, or CCAAT. The major difference of IGFBP-1 gene activation in endometrium and the hepatic system lies in the distal promoter region, between -2.6 and -3.4 kb, which mediates 95% of the total promoter activity derived from -3.3 kb to +68 bp. Functional and binding analysis in the distal promoter region showed that multiple Sp1 elements interacting with a novel Sp3 transcription factor activates the hIGFBP-1 gene promoter.

Cell Differentiation↗

PubMed1997

Existence of two translation initiation sites leading to the expression of two proteins from the rat high-affinity neurotensin-receptor cDNA: possible regulation by the 5' end non-coding region.

This work demonstrates the expression of two different proteins (47 and 44 kDa) from the rat high-affinity neurotensin receptor cDNA, observed after both translation in vitro and transient transfection into eukaryotic COS-7 cells. These two proteins are the consequence of two initiation sites of translation present in the corresponding mRNA. Site-directed mutagenesis indicated that the 47 kDa protein was generated from the first AUG codon (Met1). In contrast, suppression of the second AUG codon found in the sequence (Met27) did not modify the expression of the two proteins previously observed with the wild-type neurotensin receptor. Therefore this second translation site could correspond to a non-AUG codon. Moreover, when the 5' end untranslated region of the neurotensin receptor mRNA is deleted, the expression of the higher-molecular-mass protein is enhanced, indicating that this region could be involved in the regulation of expression of these two proteins.

Animals↗

PubMed1997

Effects of SR 48692 on neurotensin-induced calcium-activated chloride currents in the Xenopus oocyte expression system: agonist-like activity on the levocabastine-sensitive neurotensin receptor and absence of antagonist effect on the levocabastine insensitive neurotensin receptor.

The effect of the drug SR 48692 on the Ca(2+)-activated Cl- current induced by neurotensin on Xenopus oocytes injected with cRNAs encoding rodent high and low affinity neurotensin receptors, was examined. In this receptor expression system, SR 48692 failed to antagonize electrophysiological measurement of neurotensin-evoked current via the rat high affinity neurotensin receptor, whereas its application onto oocytes expressing the mouse low affinity neurotensin receptor triggered an inward current, as well as neurotensin itself. However, no current activation was observed after application of the drug on oocytes expressing the rat high affinity neurotensin receptor. These observations in the oocyte expression system did not reflect typical antagonist properties of SR 48692 drug.

Animals↗

PubMed1997

Identification and expression of a variant isoform of the levocabastine-sensitive neurotensin receptor in the mouse central nervous system.

This work describes the molecular cloning of a variant isoform of the low-affinity levocabastine-sensitive neurotensin receptor isolated from mouse brain. Although the corresponding mRNA encodes for a 282 amino acid protein unable to bind neurotensin after transient transfection in COS-7 cells, this non-functional neurotensin receptor is expressed in cerebral neocortex, cerebellum, olfactory bulb, striatum and hypothalamus with a level similar to that of the full-length low-affinity neurotensin receptor. By contrast, this receptor form is very weakly expressed in mesencephalon and absent in the pituitary, but is the major product in the spinal cord.

Amino Acid Sequence↗

PubMed1997

Identification in the rat neurotensin receptor of amino-acid residues critical for the binding of neurotensin.

In order to identify charged amino-acid residues of the cloned rat brain neurotensin (NT) receptor (NTR) that are critical for NT binding, we performed site-directed mutagenesis on the cDNA encoding this protein, followed by transient expression into mammalian COS-7 cells and in Xenopus laevis oocytes. Point substitutions of charged residues in the N-terminal part and in the 2nd and 3rd extracellular loop of the receptor either did not affect (125)I-Tyr3-NT binding or resulted in a decrease in binding affinity by a factor of 2-3. Mutations of amino acids Asp113 in the second transmembrane domain (TM) and of Arg149 or Asp150 in TM III yielded receptors that bound NT as efficiently as the native receptor. By contrast, replacement of the Asp139 residue in the 1st extracellular loop, or of Arg143 or Arg327-Arg328 residues at the top of TM III and in TM VI, respectively, completely abolished ligand binding. Confocal and EM immunocytochemical studies of the expression of these affected receptors, tagged with the C-terminal sequence of the vesicular stomatitis virus glycoprotein (VSV-G), indicated that this loss of binding was not due to altered receptor expression or to their improper insertion into the plasma membrane. When these mutated forms of neurotensin receptor were expressed into Xenopus oocytes, Asp139-Gly- and Arg143-Gly-modified receptors remained functional in spite of a lowered response to NT whereas the Arg327-Arg328 mutant form was totally insensitive to NT at concentrations up to 10 microM. In the case of the Arg327-Arg328 mutation, the observed insensibility to NT could be the result of a drastic conformational alteration of this mutant protein. By contrast, it would appear that Asp139 and Arg143 residues located in the first extracellular loop of the receptor may be directly involved in the interaction of the receptor with neurotensin.

Amino Acids↗

PubMed1997

Differential internalization of somatostatin in COS-7 cells transfected with SST1 and SST2 receptor subtypes: a confocal microscopic study using novel fluorescent somatostatin derivatives.

A growing body of evidence suggests that neuropeptide binding to G protein-linked receptors may result in internalization of receptor-ligand complexes, followed by intracellular mobilization and degradation of the ligand into its target cells. Because of discrepant results in the literature concerning the occurrence of such a mechanism for the tetradecapeptide somatostatin (SRIF), we have reinvestigated this question by comparing the binding and internalization of iodinated and fluorescent derivatives of the metabolically stable analog of SRIF, [D-Trp8]SRIF, in COS-7 cells transfected with complementary DNA encoding the sst1 or sst2A receptor subtype. A series of fluoresceinyl and Bodipy fluorescent derivatives of [D-Trp8]SRIF-14 was purified by HPLC, analyzed for purity by mass spectrometry, and tested for biological activity in a membrane binding assay. Of the six compounds tested, fluoresceinyl and Bodipy derivatives labeled in position alpha (fluo-SRIF) retained high affinity for SRIF receptors. COS-7 cells transfected with complementary DNA encoding either sst1 or sst2A receptors both displayed specific, high affinity binding of iodinated and fluo-SRIF. At 4 C, the labeling was confined to the cell surface in both cell types, as indicated by the fact that it was entirely removable by a hypertonic acid wash and assumed a pericellular distribution in the confocal microscope. At 37 C, the fate of specifically bound ligand varied markedly according to the type of receptor transfected. In cells encoding the sst1 receptor, approximately 20% of specifically bound ligand was recovered in the acid-resistant (i.e. intracellular) fraction. This fraction remained clustered at the periphery of the cell, suggesting that it was being sequestered either within or immediately beneath the plasma membrane. By contrast, in cells transfected with sst2A receptors, up to 75% of specifically bound ligand was recovered inside the cells, where it clustered into small endosome-like particles. These particles increased in size and moved toward the nucleus with time, suggestive of receptor-ligand complexes proceeding down the endocytic pathway. These results demonstrate that neuropeptides may be processed differently depending on the subtype of receptor expressed in their target cells and suggest that these different processing patterns may reflect different modes of sensitization/desensitization and recycling of the receptors, and thereby of transmembrane signaling.

Animals↗

PubMed1996

Structure, functional expression, and cerebral localization of the levocabastine-sensitive neurotensin/neuromedin N receptor from mouse brain.

This work describes the cloning and expression of the levocabastine-sensitive neurotensin (NT) receptor from mouse brain. The receptor protein comprises 417 amino acids and bears the characteristics of G-protein-coupled receptors. This new NT receptor (NTR) type is 39% homologous to, but pharmacologically distinct from, the only other NTR cloned to date from the rat brain and the human HT29 cell line. When the receptor is expressed in Xenopus laevis oocytes, the H1 antihistaminic drug levocabastine, like NT and neuromedin N, triggers an inward current. The pharmacological properties of this receptor correspond to those of the low-affinity, levocabastine-sensitive NT binding site described initially in membranes prepared from rat and mouse brain. It is expressed maximally in the cerebellum, hippocampus, piriform cortex, and neocortex of adult mouse brain.

Amino Acid Sequence↗

PubMed1996

Localization of the somatostatin receptor SST2A in rat brain using a specific anti-peptide antibody.

Biological actions of somatostatin are exerted via a family of receptors, for which five genes recently have been cloned. However, none of these receptor proteins has been visualized yet in the brain. In the present-study, the regional and cellular distribution of the somatostatin sst2A receptor was investigated via immunocytochemistry in the rat central nervous system by using an antibody generated against a unique sequence of the receptor protein. Specificity of the antiserum was demonstrated by immunoblot and immunocytochemistry on rat brain membranes and/or on cells transfected with cDNA encoding the different sst receptor subtypes. In rat brain sections, sst2A receptor immunoreactivity was concentrated either in perikarya and dendrites or in axon terminals distributed throughout the neuropil. Somatodendritic labeling was most prominent in the olfactory tubercle, layers II-III of the cerebral cortex, nucleus accumbens, pyramidal cells of CA1-CA2 subfields of the hippocampus, central and cortical amygdaloid nuclei, and locus coeruleus. Labeled terminals were detected mainly in the endopiriform nucleus, deep layers of the cortex, claustrum, substantia innominata, subiculum, basolateral amygdala, medial habenula, and periaqueductal gray. Electron microscopy confirmed the association of sst2A receptors with perikarya and dendrites in the former regions and with axon terminals in the latter. These results provide the first characterization of the cellular distribution of a somatostatin receptor in mammalian brain. The widespread distribution of the sst2A receptor in cerebral cortex and limbic structures suggests that it is involved in the transduction of both pre- and postsynaptic effects of somatostatin on cognition, learning, and memory.

Animals↗

PubMed1995

Thr-422 and Tyr-424 residues in the carboxyl terminus are critical for the internalization of the rat neurotensin receptor.

In order to identify the amino acid sequences responsible for the internalization of the cloned rat brain neurotensin receptor, we carried out site-directed mutagenesis of the cDNA encoding the receptor followed by expression of the receptor into mammalian COS 7 cells. In cells transfected with the full-length neurotensin receptor, 56% of iodinated neurotensin specifically bound to the cells after 60 min of incubation at 37 degrees C was internalized. Deletions made in the third intracellular loop did not affect receptor internalization. By contrast, internalization was reduced to 5% of total in cells in which almost all the carboxyl-terminal tail of the receptor had been deleted (R392stop). In order to determine which part of the tail was responsible for this effect, several Ser and Thr residues were deleted in the carboxyl cytoplasmic sequence of the receptor. Almost all of these receptors were internalized as efficiently as the wild type. Only the form of the neurotensin receptor truncated at Glu-421 (deletion of the last three residues, TLY) produced a significant decrease in the amount of ligand internalized. Finally, point mutations of Thr-422 and Tyr-424 residues to Gly led to an almost complete loss of ligand internalization demonstrating the involvement of these 2 residues in the internalization process. Replacement of the last three amino acids by the cytoplasmic endocytosis signal of the vesicular stomatitis virus did not restore the efficiency of neurotensin receptor internalization. These biochemical results were confirmed by confocal microscopic analysis. Cell transfected with the wild type receptor showed a temperature-dependent intracellular accumulation of a fluorescent analog of neurotensin, whereas cells transfected with a receptor truncated at the carboxyl terminus showed a clustering of the fluorescent peptide at the cell surface.

Amino Acid Sequence↗

PubMed1995

Progestin and antiprogestin differentially regulate the expression of insulin-like growth factors (IGF-I and IGF-II) messenger ribonucleic acid in human endometrial stromal cells.

Previous studies have shown that insulin-like growth factors (IGF-I and IGF-II) stimulate mitogenic activity in human endometrial stromal cells. In the present study, we have investigated the expression of IGF-I and -II mRNA to ascertain any autocrine growth-promoting effect in this system. Northern blot analysis revealed that endometrial stromal cells express multiple sizes of IGF-I and -II transcripts. The effect of progestin and antiprogestin was studied during decidualization of endometrial stromal cells in long-term culture. Solution hybridization and a ribonuclease protection assay of control cells revealed that the level of IGF-I mRNA was low, whereas IGF-II mRNA was always abundant. Medroxyprogesterone acetate (MPA) stimulated the expression of IGF-I mRNA > 4-fold in predecidualized cells during the first 10 days of culture. IGF-I mRNA decreased to basal level in prolonged culture when cells were decidualized. In contrast, MPA suppressed the IGF-II mRNA level by 60% in predecidualized cells, but IGF-II mRNA was highly expressed after 20 days of incubation with MPA (5-fold increase from Days 5-10 to Day 20 of culture). In progestin-pretreated cells, addition of the antiprogestin RU486 for 1-4 days reduced IGF-I mRNA by 50-90%. RU486 reversed the suppressive effect of MPA and increased IGF-II mRNA. This study indicates that progestin and antiprogestin differentially regulate IGF-I and IGF-II mRNA levels in human endometrial stromal cells.

Cells, Cultured↗

PubMed1995

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)

Adenocarcinoma↗

PubMed1995

[3H]SR 48692, the first nonpeptide neurotensin antagonist radioligand: characterization of binding properties and evidence for distinct agonist and antagonist binding domains on the rat neurotensin receptor.

The binding of [3H]SR 48692, a new potent and specific nonpeptide neurotensin (NT) receptor antagonist, was characterized in membranes from mouse fibroblast LTK- cells stably transfected with the G protein-coupled rat NT receptor. The binding of [3H]SR 48692 was specific, time dependent, reversible, and saturable. Scatchard analysis of saturation experiments indicated that [3H]SR 48692 bound to a single population of sites, with a Kd of 3.4 nM and a Bmax value that was 30-40% greater than that observed in saturation experiments with [125I]NT. Two SR 48692-related enantiomers, SR 48527 and SR 49711, were 10 and 1000 times less potent, respectively, than unlabeled SR 48692 in inhibiting [3H]SR 48692. Unlabeled NT inhibited [3H]SR 48692 binding in a complex manner that was best analyzed with a three-site model, with high (Ki = 0.22 nM) and low (Ki = 57 nM) affinity NT binding sites and a site insensitive to unlabeled NT (up to 10 microM), which represented 60, 20, and 20%, respectively, of the total number of [3h]SR 48692 binding sites. Digitonin (10 micrograms/ml) markedly reduced the proportion of NT-insensitive sites without affecting [3H]SR 48692 binding. Na+ and guanosine-5'-(gamma-thio)triphosphate differentially modulated [3H]SR 48692 and [125I]NT binding and inverted the proportions of the high and low affinity NT binding sites. A mutant rat NT receptor that contained a deletion in a region (amino acids 45-60) of the amino-terminal extracellular domain near the first transmembrane helix and was expressed in COS M6 cells retained the same affinity for [3H]SR 48692 and the same stereoselectivity for SR 48527 and SR 49711 as the wild-type receptor. In contrast, it bound NT with 3000-fold lower potency. In conclusion, the data indicate that [3H]SR 48692 represents a new, potent, nonpeptide antagonist radioligand of the NT receptor that differentiates between agonist- and antagonist-receptor interactions. Furthermore, the data demonstrate that the peptide agonist and the nonpeptide antagonist bind to distinct regions of the NT receptor.

Animals↗