PubMed Health⌕ Search

Biomedical subjects

J Mundy

Publications and source records attributed to J Mundy.

At least 55 records · Page 3Linked to original sources
PubMed1992

Gut protection by cyclophosphamide "priming" in patients receiving high-dose melphalan--effect of drug scheduling.

A "priming" injection of cyclophosphamide (400 mg/m2 given i.v. on day -7) has been shown to reduce intestinal permeability and thus gut toxicity in patients receiving high-dose melphalan. To determine the optimal timing for this injection, patients receiving 200 mg/m2 melphalan with an autologous bone marrow transplant were randomly assigned to receive cyclophosphamide at 5, 7 or 9 days before the melphalan. The median percentage of [51Cr]-ethylenediaminetetraacetic acid excretion was similar (9.1% vs 7.1% vs 7.7%, respectively), with equivalent duration of WHO grade 2-4 mucositis and diarrhoea being recorded for each group. Thus, the timing of the cyclophosphamide prime is not critical, and the priming injection may be given between 5 and 9 days prior to high-dose melphalan.

Bone Marrow Transplantation↗
PubMed1991

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Abscisic Acid↗
PubMed1991

Biochemical and molecular characterization of three barley seed proteins with antifungal properties.

We have purified three proteins from barley (Hordeum vulgare L.) seeds which synergistically inhibit the growth of fungi measured in a microtiter well assay. The proteins are a 26-kDa chitinase, a 30-kDa ribosome-inactivating protein, and a 32-kDa (1-3)-beta-glucanase. Full-length cDNAs encoding them were isolated and sequenced to determine the complete primary structures of the proteins. Northern hybridizations with the cDNAs as probes showed that the corresponding mRNAs accumulate differentially during seed development and germination. Chitinase mRNA accumulates to high levels in aleurone cells during late seed development and early germination, while high levels of mRNA encoding the ribosome-inactivating protein accumulate only in the starchy endosperm during late seed development. The glucanase mRNA accumulates to low levels during seed development and to higher levels in aleurone and seedling tissues during germination. Southern hybridizations showed that the three proteins are encoded by small families of three to eight genes. Their biological roles and potential use in genetic engineering studies are discussed.

Amino Acid Sequence↗
PubMed1991

Regulation of the maize rab17 gene promoter in transgenic heterologous systems.

The maize rab17 gene is expressed in different plant parts in response to ABA and osmotic stress (J. Vilardell et al., Plant Mol Biol 14 (1990) 423-432). Here we demonstrate that 5' upstream sequences of the rab17 gene confer the appropriate patterns of expression on the chloramphenicol acetyl transferase (CAT) reporter gene in transgenic tobacco plants, as well as in protoplasts derived from cultured rice cells. Specifically, a CAT construct containing a large 5' upstream fragment of rab17 (-1330/+29) results in high levels of CAT activity in embryos, leaves and roots of transgenic plants subjected to water stress or ABA treatment. Transient expression assays in rice protoplasts transfected with CAT genes fused to rab17 promoter deletions indicate that a 300 bp DNA fragment (-351/-102) is sufficient to confer ABA responsiveness upon the reporter gene. Furthermore, a 100 bp sequence (-219/-102) is capable of conferring ABA responsiveness upon a minimal promoter derived from the 35S CaMV promoter. Gel retardation experiments indicate that maize nuclear proteins bind to this fragment. This region of 100 bp contains a sequence (ACGTGGC) which has been identified as an abscisic acid response element in studies of other ABA-responsive plant genes.

Cell Nucleus↗
PubMed1990

Four tightly linked rab genes are differentially expressed in rice.

We have cloned and sequenced the four members of a rice rab (responsive to abscisic acid) gene family that are tandemly arrayed in a locus approximately 30 kbp in length. Each of the genes contains a single, small intron. They are all transcriptionally active and encode proteins of Mr 15,500-16,800 with two highly conserved domains. Northern analysis with gene-specific probes showed slightly different patterns of expression for the four genes in rice plant tissues and in response to osmotic stress. Comparison of the promoter regions revealed a conserved GC-rich sequence (CGG/CCGCGCT) with some homology to the SP1 binding site (Briggs et al., 1986). Another conserved sequence (PuTACGTGGCPu), whose core is found in the promoter regions of ABA-responsive cotton genes, is reminiscent of the cAMP responsive element (Deutsch et al., 1988).

Abscisic Acid↗
PubMed1990

Differential expression of two related organ-specific genes in pea.

We have screened a pea genomic library using a cDNA probe derived from pea shoot RNA. From this screen, we isolated two closely related genes, designated as S2 and P4. An intriguing property of these two genes is the presence in their coding region of a repeated sequence that is conserved between them in sequence but not in the number of the repeating units. The predicted amino acid sequence suggests that these proteins could be exported and glycosylated. 3' S1 analysis reveals that one of the genes, S2, is expressed highly in stem, as expected from previous work. However, mRNA derived from the other gene, P4, is not detectable in stem tissue, but is present in tissue derived from pea pods. The 5' upstream sequence of S2 and P4 are 94% identical up to position -121, suggesting that sequences upstream of -121 are responsible for organ-specific expression of the two genes.

Amino Acid Sequence↗
PubMed1990

Analysis of an ABA-responsive rice gene promoter in transgenic tobacco.

We have analyzed in transgenic tobacco the expression of a chimeric gene containing 5' sequences of the rice rab-16B gene fused to the beta-glucuronidase (GUS) reporter gene. This construct, a translational fusion (-482 to +184) including 14 amino acids of the RAB-16B protein, is expressed only in zygotic and pollen-derived embryos. In zygotic embryos, GUS activity begins to accumulate 10 days after flowering (daf), and increases until seed maturation at 25 daf. Immunological measurements of endogenous abscisic acid (ABA) accumulation in these seeds showed a close parallel between hormone levels and GUS activity. However, GUS activity could not be reproducibly induced by treatment of immature embryos with ABA (10 microM). Neither GUS activity nor GUS mRNA could be detected in leaves of transgenic tobacco even after ABA treatment. In contrast, GUS activity could be induced to high levels in pollen-derived embryos by treatment with ABA. Our results show that 482 bp of 5' sequences of the rice rab-16B promoter can confer in transgenic tobacco developmentally regulated expression in embryos but not ABA-responsive expression in vegetative tissues.

Abscisic Acid↗
PubMed1990

Nuclear proteins bind conserved elements in the abscisic acid-responsive promoter of a rice rab gene.

We have previously shown that the expression of a rice gene, rab-16A, is responsive to abscisic acid (ABA) and osmotic stress in plant tissues and cultured suspension cells. We demonstrate here that transcriptional elements between -294 and -52 of this gene are sufficient to confer ABA-dependent expression on the chloramphenicol acetyltransferase reporter gene in rice protoplasts. Sequence motifs within this 242-base-pair region of the rab-16A gene are conserved among the 5' upstream regions of other ABA-responsive genes. Gel retardation and DNAse I experiments show nuclear factor(s) binding to these sequences. This correlative data indicate that these motifs are involved in the transcription of the rab genes and suggest that they may be ABA-responsive-elements (ABREs).

Abscisic Acid↗
PubMed1990

A morphometric study of the human endometrial stroma during the peri-implantation period.

In this study we have examined the human endometrial stromal cell population in well-timed biopsies during the peri-implantation period, using traditional stereological techniques. This paper reports data obtained from 16 women of known fertility who underwent endometrial biopsies at known times after the luteinizing hormone (LH) surge (four each at LH + 2, LH + 4, LH + 6 and LH + 8). The average stromal cell nuclear diameter increased in size throughout the period of study (P less than 0.01), with a significant decrease (P less than 0.05) in the nuclear profile axial ratio. This suggests that the nuclei were increasing in size and becoming more rounded. There was a dramatic increase (P less than 0.01) in the packing density between LH + 2 and LH + 6; this is likely to be due, at least in part, to the glands filling up with secretory products and so compressing the intervening stroma. A substantial decrease (P less than 0.01) was seen in the packing density between LH + 6 and LH + 8. This corresponds to the time when stromal oedema is thought to be maximal.

Adult↗
PubMed1990

A morphometric study of the human endometrial stroma during the peri-implantation period.

In this study we have examined the human endometrial stromal cell population in well-timed biopsies during the peri-implantation period, using traditional stereological techniques. This paper reports data obtained from 16 women of known fertility who underwent endometrial biopsies at known times after the luteinizing hormone (LH) surge (four each at LH + 2, LH + 4, LH + 6 and LH + 8). The average stromal cell nuclear diameter increased in size throughout the period of study (P less than 0.01), with a significant decrease (P less than 0.05) in the nuclear profile axial ratio. This suggests that the nuclei were increasing in size and becoming more rounded. There was a dramatic increase (P less than 0.01) in the rounded. There was a dramatic increase (P less than 0.01) in the packing density between LH + 2 and LH + 6; this is likely to be due, at least in part, to the glands filling up with secretory products and so compressing the intervening stroma. A substantial decrease (P less than 0.01) was seen in the packing density between LH + 6 and LH + 8. This corresponds to the time when stromal oedema is thought to be maximal.

Adult↗
PubMed1989

The clinical correlates of serum CA125 in 169 patients with epithelial ovarian carcinoma.

Serial CA125 measurements in 169 patients with epithelial ovarian carcinoma were obtained. Changes in serum CA125 measurements are shown to reflect changes in clinical status. For patients with macroscopic disease receiving chemotherapy, the sensitivity and specificity for predicting response are shown to be 95% and 86% respectively. For patients with no known disease, the sensitivity and specificity for detecting relapse are shown to be 86% and 91% respectively. The clinical correlates with the level of serum CA125 were examined and the most important is shown to be amount of residual disease.

Antigens, Tumor-Associated, Carbohydrate↗
PubMed1989

The prognostic significance of the half-life of serum CA 125 in patients responding to chemotherapy for epithelial ovarian carcinoma.

Various prognostic factors were studied in 29 patients with stage III or IV ovarian cancer who responded to initial chemotherapy after initial diagnostic surgery. The half-life of CA 125 in serum during initial chemotherapy was the most important prognostic indicator for survival (P less than 0.001) and the chance of achieving complete remission (P = 0.012). A CA 125 half-life of less than 20 days, 20-40 days and greater than 40 days appears to identify patients with a good, intermediate or poor prognosis, the two year actuarial survival being 76%, 48% and 0% respectively. The change of achieving a complete remission was 15% and 67% respectively for patients with a serum CA 125 half-life of greater than 20 or less than 20 days.

Antigens, Tumor-Associated, Carbohydrate↗
PubMed1988

Abscisic acid and water-stress induce the expression of a novel rice gene.

We have identified a novel rice gene, called RAB 21, which is induced when plants are subject to water-stress. This gene encodes a basic, glycine-rich protein (mol. wt 16,529) which has a duplicated domain structure. Immunoblots probed with antibodies raised against beta-galactosidase/RAB 21 fusion protein detect RAB 21 protein only in cytosolic cell fractions. RAB 21 mRNA and protein accumulate in rice embryos, leaves, roots and callus-derived suspension cells upon treatment with NaCl (200 mM) and/or the plant hormone abscisic acid (10 microM ABA). The effects of NaCl and ABA are not cumulative, suggesting that these two inducers share a common response pathway. Induction of RAB 21 mRNA accumulation by ABA is rapid (less than 15 min in suspension cells) and does not require protein synthesis, indicating that preformed nuclear and/or cytosolic factors mediate the response to this hormone. We have characterized the RAB 21 gene by determining the complete nucleotide sequence of a nearly full-length cDNA and corresponding genomic copy, and by mapping the start site of its major transcript. The proximal promoter region contains various GC-rich repeats.

Abscisic Acid↗
PubMed1987

Cyclophosphamide priming reduces intestinal damage in man following high dose melphalan chemotherapy.

A small pre-treatment 'priming' dose of cyclophosphamide will reduce gut damage due to high dose i.v. melphalan in mice and sheep but efforts to demonstrate this effect in man have been hampered by difficulty in the measurement of gut damage. We have evaluated the 51CR EDTA absorption test, a new method for measuring intestinal permeability, as a means of assessing damage due to high dose melphalan. The test was reliable, with a narrow normal range, easy to use and well tolerated. It detected an increase in intestinal permeability after high dose melphalan with a maximum occurring between 9 and 15 days after treatment and subsequently returning to normal. It was shown in 19 patients that a pre-treatment dose of cyclophosphamide was capable of significantly reducing the abnormalities in intestinal permeability which resulted from high dose melphalan.

Adult↗
PubMed1986

Differential synthesis in vitro of barley aleurone and starchy endosperm proteins.

To widen the selection of proteins for gene expression studies in barley seeds, experiments were performed to identify proteins whose synthesis is differentially regulated in developing and germinating seed tissues. The in vitro synthesis of nine distinct barley proteins was compared using mRNAs from isolated endosperm and aleurone tissues (developing and mature grain) and from cultured (germinating) aleurone layers treated with abscisic acid (ABA) and GA(3). B and C hordein polypeptides and the salt-soluble proteins beta-amylase, protein Z, protein C, the chymotrypsin inhibitors (CI-1 and 2), the alpha-amylase/subtilisin inhibitor (ASI) and the inhibitor of animal cell-free protein synthesis systems (PSI) were synthesized with mRNA from developing starchy endosperm tissue. Of these proteins, beta-amylase, protein Z, and CI- 1 and 2 were also synthesized with mRNA from developing aleurone cells, but ASI, PSI, and protein C were not. CI-1 and also a probable amylase/protease inhibitor (PAPI) were synthesized at high levels with mRNAs from late developing and mature aleurone. These results show that mRNAs encoding PAPI and CI-1 survive seed dessication and are long-lived in aleurone cells. Thus, expression of genes encoding ASI, PSI, protein C, and PAPI is tissue and stage-specific during seed development. Only ASI, CI-1, and PAPI were synthesized in significant amounts with mRNA from cultured aleurone layers. The levels of synthesis of PAPI and CI-1 were independent of hormone treatment. In contrast, synthesis of alpha-amylase (included as control) and of ASI showed antagonistic hormonal control: while GA promotes and ABA reduces accumulation of mRNA for alpha-amylase, these hormones have the opposite effect on ASI mRNA levels.

Journal Article↗
PubMed1985

Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase.

Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley. In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation products were identical for each enzyme.

Journal Article↗