Biomedical subjects

J Roux

Publications and source records attributed to J Roux.

At least 19 recordsLinked to original sources

PubMed2006

Anisotropic photon migration in human skeletal muscle.

It is demonstrated in the short head of the human biceps brachii of 16 healthy subjects (12 males and 4 females) that near infrared photon migration is anisotropic. The probability for a photon to travel along the direction of the muscle fibres is higher (approximately 0.4) than that of travelling along a perpendicular axis (approximately 0.3) while in the adipose tissue the probability is the same (approximately 0.33) in all directions. Considering that the muscle fibre orientation is different depending on the type of muscle considered, and that inside a given skeletal muscle the orientation may change, the present findings in part might explain the intrasubject variability observed in the physiological parameters measured by near infrared spectroscopy techniques. In other words, the observed regional differences might not only be physiological differences but also optical artefacts.

Adult↗

PubMed2005

Prenatal evaluation of kidney function in mice using dynamic contrast-enhanced magnetic resonance imaging.

Glomerular differentiation starts as soon as embryonic stage 12 in mice and suggests that kidneys may be functional at this stage. Dynamic contrast-enhanced magnetic resonance microscopy, a noninvasive imaging technique, was used to assess renal function establishment in utero. Indeed, in adults (n = 3), an intravenous injection of gadolinium-DOTA induced in a first step a massive and rapid drop in kidney signal intensity followed, in a second step, by a drop in bladder signal intensity. The delay in signal changes between kidney and bladder reflected glomerular filtration. Pregnant mice underwent anatomical and dynamic contrast-enhanced magnetic resonance microscopy on postcoital days 12-13 (n = 2), 13-14 (n = 1), 14-15 (n = 3), 15-16 (n = 2), 16-17 (n = 3), 17-18 (n = 3), and 18-19 (n = 1). Kidneys and bladder were unambiguously depicted prior to contrast agent injection on stage 15-16 embryos. Contrast agent injection allowed kidney, detection as early as stage 12-13 but not bladder. Kinetics of signal changes demonstrated that glomerular filtration is established at embryonic stage 15-16 in mice. Thus, anatomical and dynamic contrast-enhanced magnetic resonance microscopy may be a powerful noninvasive method for in vivo prenatal developmental and functional studies.

Animals↗

PubMed2005

Description and technical pitfalls of a hepatoma model and of intra-arterial injection of radiolabelled lipiodol in the rat.

Intra-arterial metabolic radiotherapy (using lipiodol labelled with iodine-131 or rhenium-188) is a therapeutic approach that can be used for the treatment of hepatocellular carcinomas (HCC). We propose a detailed description of the tumoral model using the N1-S1 cell line as well as a technique for intra-arterial injection of radiolabelled lipiodol in order to undertake preclinical studies necessary for the evaluation of a new molecule. We also report the principal technical pitfalls that were faced. The speed of injection of the tumoral cells is a key factor in the tumoral induction since slow injections lead to a tumoral induction rate of 36.3% compared with 76.6% (P<0.01) when using very slow injections. This parameter should thus be controlled carefully during the subcapsular injection of the tumoral cells. In addition, when injecting radiolabelled lipiodol, anaesthesia should not be performed with isoflurane since this leads to a reduction in tumoral uptake. Indeed, we found a 'tumour/healthy liver' uptake ratio of only 2.1+/-0.7 with isoflurane as against 4.4+/-2.6 (P<0.05) when anaesthesia was carried out by intraperitoneal injection of ketamine. Lastly, we show that the tumour size has an influence on the tumoral uptake of radiolabelled lipiodol; therefore, this parameter must also be carefully controlled.

Anesthetics↗

PubMed2005

[The history of lymphatic filarlasis control programme in French Polynesia: lessons from a 50 years effort].

With a mean prevalence of microfilariaemia superior to 15% in the four archipelagos of the territory French Polynesia was confronted with a huge public health problem of Wuchereria bancrofti - associated filarias during the 50s. Supported by a strong US sponsoring, a large scale control campaign based on diethylcarbamazine (DEC) distribution was launched and led to the method of spaced doses (the most useful protocol being one annual DEC dose). Progressively applied to the whole Polynesian population since 1974, this very innovative programme had generated the idea of a possible eradication of the parasitosis. Meanwhile at laboratory level important progress in Immunology (mainly the validation of rapid diagnosis tests detecting a specific antigenemia) and later in Molecular Biology (with the main application being the follow-up of the infection status of the vector Aedes polynesiensis) questioned this optimistic concept (one lesson given by the study of Maupiti island, considered as a 0% reference island for a long time). More recently a regional WHO-sponsorized control programme, called PacELF, has for main objective the elimination of lymphatic filariasis as a public health problem in the South Pacific region near 2010. This objective argues for using a (DEC and albendazole) drug combination cumulating micro- and macro-filaricid activities. The dream of a lymphatic filariasis free Pacific is coming back again.

Biomedical Research↗

PubMed2004

HO-1 induction restores c-AMP-dependent lung epithelial fluid transport following severe hemorrhage in rats.

Inhibition of cAMP-dependent stimulation of the vectorial fluid transport across the lung epithelium following hemorrhagic shock is mediated by NO released within the airspaces of the lung. We tested here the hypothesis that prior induction of HO-1 would attenuate the release of NO in the airspaces, thus preventing the inhibition of the c-AMP stimulation of alveolar fluid clearance (ALC) in rats. Indeed, HO-1 induction restored the cAMP-mediated up-regulation of ALC after hemorrhage by decreasing NO released within the airspaces of the lung. In vitro studies demonstrated that HO-1 induction significantly reduced the iNOS-mediated release of NO by alveolar macrophages stimulated with endotoxin for 24 h. This effect is explained in part by a HO-1-dependent attenuation of the LPS-mediated nuclear translocation of NF-kappaB. In addition, HO-1 induction also significantly reduced the iNOS-mediated release of NO by MH-S cells that were stimulated with interferon-gamma by decreasing the phosphorylation of STAT 1, another transcription factor important for the activation of the iNOS promoter. In contrast, HO-1 induction did not affect the production of NO by rat alveolar epithelial type II cells that were stimulated with cytomix (a mixture of TNF-alpha, IL-1beta, and IFN-gamma) for 24 h. In summary, these results provide the first in vivo evidence that the induction of HO-1 in the lung restores a normal fluid transport capacity of the alveolar epithelium following hemorrhagic shock by inhibiting the iNOS-mediated release of NO by alveolar macrophages.

Animals↗

PubMed2004

Malaria transmission in Southern Madagascar: influence of the environment and hydro-agricultural works in sub-arid and humid regions. Part 1. Entomological investigations.

A 4-year entomological study was carried out in Southern Madagascar to identify malaria vectors, evaluate the transmission and compare the influence of irrigation in the sub-arid and adjacent humid regions. Three villages were involved in this entomological survey: Androvasoa (located in the natural sub-arid ecosystem), Pépiniére (sited at the centre of an irrigated rice scheme in the sub-arid region) and Esana (bordered with rice fields in the humid region). Mosquitoes were collected inside and outside dwellings when landing on human beings, with light traps and with knockdown indoor sprays. Anopheles arabiensis, Anopheles merus and Anopheles funestus were found in every village while Anopheles gambiae s.s. was only found in the village bordering the rice-fields (Pépiniére) and Anopheles mascarensis, a mosquito native to Madagascar, was only found in the humid region (Esana). In Pépiniére, the annual entomological inoculation rate (EIR) was low (EIR=0.4 infective bites/man/year (IBM)). In the irrigated scheme of the sub-arid region, malaria transmission was 150 times higher (mean EIR=63 IBM) than in the natural ecosystem and A. funestus was the main vector, responsible for 90% of infective bites. In Esana, the level of malaria transmission was high (EIR=41 IBM) and 2/3 of the infective bites were due to A. mascarensis, despite the presence of A. gambiae s.s. and A. funestus. These results are discussed with reference to the impact of irrigation on malaria in Africa ("the paddies paradox").

Animals↗

PubMed2002

In utero time-course assessment of mouse embryo development using high resolution magnetic resonance imaging.

Magnetic resonance microscopy, a non-invasive imaging technique was used for a longitudinal follow-up of mouse embryonic development in utero and for the assessment of embryonic kidney function using 50 nm magnetite dextran particles. Even though the morphologic proton images obtained were still far from classical histological slices quality, an in-plan resolution of 195 microm was achieved for a slice thickness of 800 microm. Mouse embryos sub-structures such as the fourth ventricle, the mesencephalic vesicle, the aorta or the liver can be revealed as early as E11/12. Heart, diaphragm, spinal cord, third, fourth and lateral ventricles were unambiguously seen at E13/14; whereas skeleton, tail, kidney and digit can only be seen from E15/16. Kidney and bladder were certainly identified from E16 on. MR microscopy offers a possibility for in utero phenotyping of mice and can therefore be a powerful tool for post-genomic applications.

Animals↗

PubMed2002

[Benign mesothelioma of the uterus. Clinical and histopathological aspects and evidence of its mesothelial origin. Apropos of 1 case].

Benign mesothelioma is a rare tumor nearly always find in relation to the genital tract. We report the case of a 47-year, old woman admit in the gynecologic department for metrorragia. The tumor was composed of irregular tubules between smooth muscle cells, lined by flattened or cuboidal cells without nuclear atypia or mitoses. The tumor cells express cytokeratins and vimentin. Histologically, differential diagnosis can be made with adenocarcinoma or vascular proliferation like lymphangioma, hemangioma or angiomyoma. Clinical outcome is always favourable without recurrence or malignant transformation.

Diagnosis, Differential↗

PubMed2002

Relationship between parasite density and fever risk in a community exposed to a low level of malaria transmission in Madagascar highlands.

To establish a simple definition of a malaria attack based on blood parasite density and other explanatory covariates, a cohort study was conducted from 1993 to 1996 in the Madagascar highlands undergoing a low seasonal transmission of falciparum malaria. Using logistic regression, the explanatory variables found to be significantly related to the risk of fever are parasite density, age, season, and year. However, and in contrast with other studies, we found no evidence of a clear cutoff in parasite density values consistent with the concept of "pyrogenic threshold" despite a gradual increase of the risk of fever with increasing parasite density. Furthermore, the model evidenced an individual-dependent relationship at a given age. This point was in accordance with the immunological data recorded from the participants. The investigators conclude that the parasite density to distinguish malaria attacks from other causes of fever is not reliable in a context of low falciparum transmission.

Adolescent↗

PubMed2001

Reactive nitrogen species inhibit alveolar epithelial fluid transport after hemorrhagic shock in rats.

Our recent experimental work demonstrated that a neutrophil-dependent inflammatory response in the lung prevented the normal up-regulation of alveolar fluid clearance by catecholamines following hemorrhagic shock. In this study, we tested the hypothesis that the release of NO within the airspaces of the lung was responsible for the shock-mediated failure of the alveolar epithelium to respond to catecholamines in rats. Hemorrhagic shock was associated with an inducible NO synthase (iNOS)-dependent increase in the lung production of NO and a failure of the alveolar epithelium to up-regulate vectorial fluid transport in response to beta-adrenergic agonists. Inhibition of iNOS restored the normal catecholamine-mediated up-regulation of alveolar liquid clearance. Airspace instillation of dibutyryl cAMP, a stable analog of cAMP, restored the normal fluid transport capacity of the alveolar epithelium after prolonged hemorrhagic shock, whereas direct stimulation of adenyl cyclase by forskolin had no effect. Pretreatment with pyrrolidine dithiocarbamate or sulfasalazine attenuated the iNOS-dependent production of NO in the lung and restored the normal up-regulation of alveolar fluid clearance by catecholamines after prolonged hemorrhagic shock. Based on in vitro studies with an alveolar epithelial cell line, A549 cells, the effect of sulfasalazine appeared to be mediated in part by inhibition of NF-kappaB activation, and the protective effect was mediated by the inhibition of IkappaBalpha protein degradation. In summary, these results provide the first in vivo evidence that NO, released within the airspaces of the lung probably secondary to the NF-kappaB-dependent activation of iNOS, is a major proximal inflammatory mediator that limits the rate of alveolar epithelial transport after prolonged hemorrhagic shock by directly impairing the function of membrane proteins involved in the beta-adrenergic receptor-cAMP signaling pathway in alveolar epithelium.

Adenylyl Cyclases↗

PubMed2001

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Alleles↗

PubMed2001

Zoophily of Anopheles arabiensis and An. gambiae in Madagascar demonstrated by odour-baited entry traps.

In Madagascar we used odour-baited entry traps (OBETs) for host choice tests of wild female anopheline mosquitoes (Diptera: Culicidae) at representative localities on the East and West sides of the island (villages Fenoarivo and Tsararano, respectively) and at the southern margin of the central plateau (Zazafotsy village, 800 m altitude). No insecticide house-spraying operations have been undertaken at these villages. Odours from a man and a calf of similar mass, concealed in different tents, were drawn by fans into separate OBETs set side by side. Traps were alternated to compensate for position effects, and different pairs of individual baits were employed for successive replicates. Totals of 266 An. funestus Giles sensu stricto and 362 An. gambiae Giles sensu lato were collected in 48 trap nights during March-June 1999. For each mosquito species the 'index of anthropophily' was defined as the proportion of females caught in the human-baited trap. For An. funestus this index was found to be consistently greater than 0.5 (value for random choice between traps/hosts), indicating that this species 'preferred' human to calf odour (index=0.83). Conversely, the index of anthropophily for An. gambiae s.l. indicated they 'chose' calf in preference to human odour (index=0.26). No significant differences of relative preference for calf or man were detected between villages; geographical variance accounted for <8% of the total experimental variance. Molecular identifications of 181 specimens of the An. gambiae complex (approximately 50% of the samples) revealed only An. arabiensis Patton at Tsararano and Zazafotsy, but >97% An. gambiae Giles sensu stricto at Fenoarivo, in accordance with prior knowledge of the differential distributions of these sibling species on the island. Predominant zoophily (i.e. intrinsic 'preference' for cattle odours) by both An. arabiensis and An. gambiae s.s. in Madagascar contrasts with their greater anthropophily in continental Africa.

Animals↗

PubMed2001

Predominance of serotype-specific mucosal antibody response in Shigella flexneri-infected humans living in an area of endemicity.

The mucosal humoral immune response elicited following Shigella flexneri infection in patients living in Antananarivo districts (Madagascar Island) was evaluated by measuring the gut-derived, circulating immunoglobulin A (IgA) antibody-secreting cells (ASC) specific for the major bacterial antigen lipopolysaccharide (LPS). Fifty, 34, 11, and 5% of the S. flexneri-positive patients were infected with serotypes 2a, 1a, 4a, and 3a, respectively. The total number of IgA ASC in infected patients increased significantly, compared to the number in healthy controls, early after the onset of disease. The number of anti-homologous LPS IgA ASC varied among individuals and peaked between days 5 and 10 after the onset of the disease. In the S. flexneri 1a- and 2a-infected patients, the level of IgA ASC cross-reactivity to heterologous S. flexneri serotypes was weak. These data indicate that S. flexneri 2a and 1a are the predominant strains responsible for shigellosis in this area of endemicity and that the anti-LPS antibody response following natural infection is mainly directed against serotype-specific determinants.

Antibodies, Bacterial↗

PubMed2001

Total and structured water in cancer: an NMR experimental study of serum and tissues in DMBA-induced OF1 mice.

Total water and structured water (fraction of total water which remains unfrozen below the transition point from the semisolid to solid state) were characterized by 1H NMR relaxometry in the sera and tissues of 3 groups of 30 female mice (C, H and L) receiving a single administration of DMBA and different diets. Mice given the diet H, containing the highest proportion of saturated fatty acids and processed starch, and the lowest phytochemicals content, presented the highest tumor incidence (lymphoma). This allowed 3 subgroups to be defined: subnormal (SN), small (T+) and large tumor (T++). Spin-lattice relaxation times of total water (Tlobs) in the sera and tissues did not significantly differ between C, H and L groups, and SN, T+ and T++ subgroups. In T+ mice, a decrease in the relative amount of structured water was noticed in the serum, liver and heart, while changes in the temperature dependence of the Tl of structured water (Tlsw) were observed between -21 degrees C and -42 degrees C. These results suggest a moderate increase in the rotational mobility of structured water molecules in the serum and the heart, and a pronounced decrease in the liver. Likewise, the modification of the Tlsvv temperature dependence curve's shape tends to confirm the existence of important conformational changes in the macromolecular assemblies, which markedly affect the properties of structured water, especially in the earliest stage of cancer development.

9,10-Dimethyl-1,2-benzanthracene↗

PubMed2000

Effects of gestational hypoxia on mRNA levels of Glut3 and Glut4 transporters, hypoxia inducible factor-1 and thyroid hormone receptors in developing rat brain.

Alterations of brain development result from noxious intrauterine signals, as oxygen deprivation, which decrease glucose energetic yield. To verify the hypothesis that a defect of brain energetic adaptation is responsible for these alterations, we have studied the effects of gestational hypoxia (10% oxygen during the last 2 weeks of fetal life) on cerebral ontogenesis of glucose transporters which control the limiting step of glucose utilization by neurons. This study is realised in rats by quantification of whole brain Glut3 and Glut4 mRNA in 14- and 19-day-old embryos (E14, E19), newborn (P0) and 7 postnatal-day-old rats (P7) by using reverse transcription-polymerase chain reaction (RT-PCR) method. We have associated our study with the analysis of a transcriptional factor, the hypoxia inducible factor-1alpha (HIF-1alpha), known to control the expression of glucose transporter, and with a family of transcriptional factors, the thyroid hormone receptors (TR), regulating specific genes involved in brain development. The data show (1) for the first time the Glut4 and HIF-1alpha gene expression in fetal rat brain which are detected as soon as E14, (2) that gestational hypoxia induces an increase of mRNA transcript levels of Glut3, Glut4, TRalpha2, TRbeta1 and HIF-1alpha genes mainly or exclusively at E14, and (3) that the absence of response of Glut3 and HIF-1alpha at E19 in hypoxic vs. normoxic group could indicate an insufficient energetic adaptation at this period of development which could lead to the neural alterations observed postnatally.

Aging↗

PubMed2000

Current epidemiology of human plague in Madagascar.

From 1996 to 1998, 5,965 patients with suspected plague were identified in 38 districts of Madagascar (40% of the total population are exposed). Using standard bacteriology, 917 of them were confirmed or presumptive (C + P) cases. However, more than 2,000 plague cases could be estimated using F1 antigen assay. Two out of the 711 Yersinia pestis isolates tested were resistant to chloramphenicol and to ampicillin (both isolates found in the harbour of Mahajanga). Urban plague (Mahajanga harbour and Antananarivo city) accounted for 37.4% of the C + P cases. Bubonic plague represented 97.2% of the cases, and the lethality rate was still high (20%). In comparing the exposed population, plague was more prevalent in males (M:F sex ratio 1.3:1) and patients under 20 years (2.7% babies under two years). Buboes were mainly localised in the inguinal/femoral regions (55.8%). The epidemiological risk factors are discussed.

Adolescent↗

PubMed2000

Mefloquine-resistant strains of Plasmodium falciparum in Madagascar: impact on tourists and public health.

Although the national policy for malaria control in Madagascar is to use chloroquine as the first line of treatment, mefloquine has been and is recommended to travellers to the country, both for malaria prevention and cure. The in-vitro susceptibility of Plasmodium falciparum to mefloquine was therefore assessed during a prospective surveillance study in various areas in Madagascar, including the tourist sites of Nosy-be and Sainte Marie. Of the 254 isolates of P. falciparum successfully tested, 232 (90.9%) were sensitive to mefloquine, 12 (4.7%) showed decreased susceptibility (40 nM < IC50 < 50 nM), and 10 (3.9%) were resistant (IC50 > 50 nM). Five (50%) of the resistant strains and nine (75%) of those with decreased susceptibility were from coastal areas or the two tourist sites. The drug pressure that could have induced the resistance observed could therefore be related to the donation of antimalarials, such as mefloquine, by tourists to local populations. The residents of the coastal areas take any donated drugs as self-medication, ignoring recommended doses and durations of treatment. This situation has two main consequences: (1) there is an urgent need to control the abusive and incorrect use of antimalarial drugs in Madagascar, to safeguard the effectiveness of chemotherapy in the future; and (2) these increases in resistance compromise the efficiency of the antimalarial chemoprophylaxis currently recommended to tourists. The use of mefloquine can no longer be considered as a guarantee of protection against malaria in coastal areas and other sites frequented by tourists.

Animals↗

PubMed2000

[Pretibial epidermolysis bullosa and hypothyroidism].

BACKGROUND: We report a case of primary non-autoimmune hypothyroidism causing pretibial epidermolysis bullosa. CASE REPORT: A 70-year-old man with primary non-autoimmune hypothyroidism developed blisters of different ages on the lateral aspect of both legs. Pathology reported blisters with subepidermal cleavage. Direct immunofluorescence was negative. Electron microscope examination showed a variable cleavage level and diffuse infiltration of a granulous and amorphous microfibrillar substance. After hormone replacement therapy, euthyroidism was associated with a reduction in the number of bullae and finally complete remission. After 12 months follow-up, the patient has not experienced recurrence. DISCUSSION: Recurrence-free clinical improvement after hormone replacement therapy suggests the diagnosis of hypothyroidism pretibial epidermolysis bullosae. Mochizuki et al. described a similar case which rapidly regressed after hormone therapy but where the electron microscope showed a different cleavage level. These bullae appear to result from a mechanical mechanism due to their localization in areas exposed to friction and also to the presence of bullae of different ages. This hypothesis is confirmed by the presence of a variable level of cleavage and a substance dense to electrons at electron microscopy as well as by the skin weakness. Our case confirms the reality of hypothyroidism pretibial epidermolysis bullosa. Thyroid hormones should be assayed in patients presenting pretibial bullae.

Aged↗