PubMed Health⌕ Search

Biomedical subjects

J W Lin

Publications and source records attributed to J W Lin.

At least 19 recordsLinked to original sources
PubMed2001

Riboflavin synthesis genes ribE, ribB, ribH, ribA reside in the lux operon of Photobacterium leiognathi.

Nucleotide sequence of the riboflavin synthesis genes ribE, ribB, ribH, ribA (GenBank Accession No. AF364106) resided in the lux operon of Photobacterium leiognathi PL741 has been determined, and the amino acid sequences of riboflavin synthetase (RibE), DHBP synthetase (RibB), lumazine synthetase (RibH), GTP cyclohydrolase II (RibA) encoded by the riboflavin synthesis genes are deduced. Nucleotide sequence reveals that the ribE gene encodes the riboflavin synthetase responsible for converting lumazine to riboflavin, the ribB gene encodes the DHBP synthetase responsible for 3,4-dihydroxyl-2-butanone 4-phosphate synthesis, the ribH gene encodes the lumazine synthetase responsible for lumazine synthesis, and the ribA gene encodes the GTP cyclohydrolase II responsible for lumazine synthesis. Functional analysis illustrates that the specific segments lay behind the ribH and ribA genes might form potential loops Omega(oT) and Omega(TI)--Omega(TII); Omega(oT) is functioned as mRNA stability loop or/and for subregulation by alternative modulation, and Omega(TI)--Omega(TII) could be the transcriptional terminator of the lux operon. The gene order of the ribE, ribB, ribH, ribA genes resided in the lux operon and linked to the lum operon is <--ter*-lumQ-lumP-R&R-luxC-luxD-luxA-luxB-luxN-luxE-luxG-ribE-ribB-ribH-ribA-ter--> (R&R: regulatory region; ter: transcriptional terminator), whereas the R&R is the regulatory region for the lum and the lux operons, and ter and ter* are the transcriptional terminators for the lux and lum operons.

Amino Acid Sequence↗
PubMed2001

Characterization of stress-responsive genes, hrcA-grpE-dnaK-dnaJ, from phytopathogenic Xanthomonas campestris.

Sequencing of a 6.4-kb DNA fragment, cloned from the plant pathogenic bacterium Xanthomonas campestris pv. campestris 17 revealed five ORFs whose deduced amino acid sequences show strong similarities to the bacterial HrcA, GrpE, DnaK, DnaJ, and PdxK. The four heat shock genes are organized in the order hrcA-grpE-dnaK-dnaJ, a genome organization found in many gram-positive bacteria, but only in one gram-negative species (Xylella fastidiosa). These observations suggest that the HrcA-CIRCE system, comprising at least four genes arranged in this order, already existed for the regulation of stress responses before bacteria diverged into gram-negative and gram-positive groups. Primer-extension results suggested the presence of promoters at the regions upstream of grpE and dnaK. In the presence of stress, heat or ethanol (4%), the X. campestris pv. campestris 17 grpE and dnaK promoters were induced two- to three-fold over controls. Since the grpE and dnaK promoters possess E. coli sigma(32) promoter-like sequences, they are functional in E. coli, although at levels much lower than in X. campestris pv. campestris 17. Furthermore, expression of the X. campestris pv. campestris 17 dnaK promoter in E. coli was elevated by the cloned X. campestris sigma(32) gene, indicating that the cognate sigma(32) works more efficiently for the X. campestris promoters.

Bacterial Proteins↗
PubMed2001

Isolated Rosai-Dorfman disease presenting as peripheral mononeuropathy and clinically mimicking a neurogenic tumor: case report.

BACKGROUND: Rosai-Dorfman disease is a rare idiopathic disorder of proliferative histiocytes affecting the lymph nodes. It usually manifests as bilateral cervical lymphadenopathy and fever with concurrent polyhyperglobulinemia. Cases involving the nervous system are quite rare; most CNS lesions are located intracranially or arise from the spinal dura or leptomeninges. To our knowledge, there has been no previous report of isolated Rosai-Dorfman disease presenting as peripheral mononeuropathy. CASE REPORT: We report a 43-year-old female with isolated extranodal Rosai-Dorfman disease in the medial aspect of the right upper arm, which presented as aberrant ulnar neuropathy caused by a mass encasing the right basilic vein and the medial anteriobrachial cutaneous branch of the right ulnar nerve. Preoperative diagnosis was a neurogenic tumor. The patient underwent excision of the mass, and pathologic examination confirmed the diagnosis of Rosai-Dorfman disease. CONCLUSION: An unusual case of extranodal isolated Rosai-Dorfman disease, presenting as peripheral mononeuropathy, is reported. Clinically, it simulated a neurogenic tumor, extending the etiologic spectrum of entrapment neuropathy of the peripheral nerve.

Adult↗
PubMed2001

Improving PET-based physiological quantification through methods of wavelet denoising.

The goal of this study was to evaluate methods of multidimensional wavelet denoising on restoring the fidelity of biological signals hidden within dynamic positron emission tomography (PET) images. A reduction of noise within pixels, between adjacent regions, and time-serial frames was achieved via redundant multiscale representations. In analyzing dynamic PET data of healthy volunteers, a multiscale method improved the estimate-to-error ratio of flows fivefold without loss of detail. This technique also maintained accuracy of flow estimates in comparison with the "gold standard," using dynamic PET with O15-water. In addition, in studies of coronary disease patients, flow patterns were preserved and infarcted regions were well differentiated from normal regions. The results show that a wavelet-based noise-suppression method produced reliable approximations of salient underlying signals and led to an accurate quantification of myocardial perfusion. The described protocol can be generalized to other temporal biomedical imaging modalities including functional magnetic resonance imaging and ultrasound.

Adult↗
PubMed2001

Plasticity of quaternary structure: twenty-two ways to form a LacI dimer.

The repressor proteins of the LacI/GalR family exhibit significant similarity in their secondary and tertiary structures despite less than 35% identity in their primary sequences. Furthermore, the core domains of these oligomeric repressors, which mediate dimerization, are homologous with the monomeric periplasmic binding proteins, extending the issue of plasticity to quaternary structure. To elucidate the determinants of assembly, a structure-based alignment has been created for three repressors and four periplasmic binding proteins. Contact maps have also been constructed for the three repressor interfaces to distinguish any conserved interactions. These analyses show few strict requirements for assembly of the core N-subdomain interface. The interfaces of repressor core C-subdomains are well conserved at the structural level, and their primary sequences differ significantly from the monomeric periplasmic binding proteins at positions equivalent to LacI 281 and 282. However, previous biochemical and phenotypic analyses indicate that LacI tolerates many mutations at 281. Mutations at LacI 282 were shown to abrogate assembly, but for Y282D this could be compensated by a second-site mutation in the core N-subdomain at K84 to L or A. Using the link between LacI assembly and function, we have further identified 22 second-site mutations that compensate the Y282D dimerization defect in vivo. The sites of these mutations fall into several structural regions, each of which may influence assembly by a different mechanism. Thus, the 360-amino acid scaffold of LacI allows plasticity of its quaternary structure. The periplasmic binding proteins may require only minimal changes to facilitate oligomerization similar to the repressor proteins.

Allosteric Site↗
PubMed2001

Cystic malignant fibrous histiocytoma of the gastrocolic ligament.

A case of malignant fibrous histiocytoma (MFH) of the gastrocolic ligament is presented. It appeared as a huge, thin walled cystic tumour in the upper abdominal cavity on CT. Barium studies showed splaying of the stomach and transverse colon by the mass. 1 year after resection of the cystic tumour, recurrence occurred at the greater curvature of the stomach and in the liver, with a cystic appearance similar to the primary tumour. To our knowledge, the CT appearance of primary cystic MFH of the gastrocolic ligament has not been previously documented.

Abdominal Neoplasms↗
PubMed2001

Use of wavelet transforms in analysis of time-activity data from cardiac PET.

UNLABELLED: Because of its intrinsic quantitative properties, PET permits measurement of myocardial perfusion and metabolism in absolute terms (i.e., mL/g/min). However, quantification has been limited by errors produced in image acquisition, selection of regions of interest, and data analysis. The goal of this study was to evaluate a newly developed, novel, wavelet-based noise-reduction approach that can objectively extract biologic signals hidden within dynamic PET data. METHODS: Quantification of myocardial perfusion using dynamic PET imaging with 82Rb, H2(15)O, and 13NH3 was selected to evaluate the effects of the wavelet-based noise-reduction protocol. Dynamic PET data were fitted to appropriate mathematic models before and after wavelet-based noise reduction to get flow estimates. Time-activity curves, precision, accuracy, and differentiating capacity derived from the wavelet protocol were compared with those obtained from unmodified data processing. A total of 84 human studies was analyzed, including 43 at rest (18 82Rb scans, 18 H2(15)O scans, and 7 13NH3 scans) and 41 after coronary hyperemia with dipyridamole (17 82Rb scans, 17 H2(15)O scans, and 7 13NH3 scans). RESULTS: For every tracer tested under all conditions, the wavelet method improved the shape of blood and tissue time-activity curves, increased estimate-to-error ratios, and maintained fidelity of flow in regions as small as 0.85 cm3. It also improved the accuracy of flow estimates derived from 82Rb to the level of that achieved with H2(15)O, which was not affected markedly by the wavelet process. In studies of patients with coronary disease, regional heterogeneity of myocardial perfusion was preserved and flow estimates in infarcted regions were differentiated more easily from normal regions. CONCLUSION: The wavelet-based noise-reduction method effectively and objectively extracted tracer time-activity curves from data with low signal-to-noise ratios and improved the accuracy and precision of measurements with all tracer techniques studied. The approach should be generalizable to other image modalities such as functional MRI and CT and, therefore, improve the ability to quantify dynamic physiologic processes.

Coronary Circulation↗
PubMed2001

Quantification of myocardial perfusion in human subjects using 82Rb and wavelet-based noise reduction.

UNLABELLED: Quantification of myocardial perfusion with 82Rb has been difficult to achieve because of the low signal-to-noise ratio of the dynamic data curves. This study evaluated the accuracy of flow estimates after the application of a novel multidimensional wavelet-based noise-reduction protocol. METHODS: Myocardial perfusion was estimated using 82Rb and a two-compartment model from dynamic PET scans on 11 healthy volunteers at rest and after hyperemic stress with dipyridamole. Midventricular planes were divided into eight regions of interest, and a wavelet transform protocol was applied to images and time-activity curves. Flow estimates without and with the wavelet approach were compared with those obtained using H2(15)O. RESULTS: Over a wide flow range (0.45-2.75 mL/g/min), flow achieved with the wavelet approach correlated extremely closely with values obtained with H2(15)O (y = 1.03 x -0.12; n = 23 studies, r = 0.94, P < 0.001). If the wavelet noise-reduction technique was not used, the correlation was less strong (y = 1.11 x + 0.24; n = 23 studies, r = 0.79, P < 0.001). In addition, the wavelet approach reduced the regional variation from 75% to 12% and from 62% to 11% (P < 0.001 for each comparison) for resting and stress studies, respectively. CONCLUSION: The use of a wavelet protocol allows near-optimal noise reduction, markedly enhances the physiologic flow signal within the PET images, and enables accurate measurement of myocardial perfusion with 82Rb in human subjects over a wide range of flows.

Adult↗
PubMed2001

Clinicopathological report of Candida granuloma from an endogenous candidal endophthalmitis.

Fluconazole was reported to be an effective alternative to Amphotericin B for candidal endophthalmitis. However, the dose for systemic use had not been determined and few pathological reports on its use have been published. An epiretinal membrane harvested from a regressed candidal endophthalmitis in a patient treated with fluconazole (200 mg/day) was sent for pathologic study. On the inner side of the retina, a granuloma was found. Fungal debris was found within the center of the granuloma, but an intact fungus was seen next to the granuloma. Pathologic study showed incomplete treatment in this case, although systemic status had improved. The use of systemic fluconazole should be maintained for a longer period of time to treat candidal endophthalmitis.

Amphotericin B↗
PubMed2000

Implication of telomerase activity and alternations of telomere length in the histologic characteristics of intracranial meningiomas.

BACKGROUND: Telomerase activity and telomere length have been shown to be involved in the control of cell proliferation and regulation of cell senescence. The expression of telomerase activity may endow cells with the capacity of unlimited proliferation and immortality. The authors examined the telomerase activity and telomere length of intracranial meningiomas to determine the relation between the results and the clinicopathologic behavior of these tumors. METHODS: Sixty-two specimens of meningiomas including 13 atypical and malignant tumors were used in this study. Telomerase activity was measured with polymerase chain reaction and enzyme-linked immunosolvent assay. Telomere length was measured by detecting the terminal restriction fragments using Southern blots. RESULTS: Detectable telomerase activity was found in 4 of 13 (30.8%) malignant or atypical meningiomas and only 1 in 49 benign meningiomas (P = 0.006). Elongated telomere length was measured in 6 of 13 (46.1%) patients with malignant or atypical meningiomas and only 1 of 48 (2.1%) in those with benign tumors (P = 0.0002). Three of 4 (75%) of malignant or atypical meningiomas with detectable telomerase activity revealed shortened telomere length, and all tumors with elongated telomere length displayed undetectable telomerase activity. The percentage of malignant or atypical meningiomas with detectable telomerase activity or elongated telomere were significantly higher (76.9%) than that of benign tumors (4.0%). The proliferative index was calculated as the percentage of tumor cell nuclei immunoreactive for Ki-67 to total tumor nuclei. The mean values of proliferative index in benign, atypical, and malignant meningiomas were 1.2, 11.0, and 30.0, respectively. CONCLUSIONS: The results indicate that telomerase activation may be a critical step in the pathogenesis of malignant or atypical meningioma. Elongation of the telomere length also implicates the high potential for malignant behavior in these tumors.

Adult↗
PubMed2000

Analysis of presynaptic Ca2+ influx and transmitter release kinetics during facilitation at the inhibitor of the crayfish neuromuscular junction.

The inhibitory synapse of the crayfish neuromuscular junction was used to examine mechanisms underlying the F2 component of synaptic facilitation. Because previous studies have shown accelerated transmitter release during facilitation, we examined whether an activity-dependent plasticity in I(Ca) could underlie this acceleration. We established that fluorescent transients generated by Magnesium Green can resolve small differences in presynaptic Ca(2+) influx that correlate with changes in IPSC waveform. However, there was no change in Ca(2+) transients associated with the accelerated release. Analyzing the initial rise of IPSC and the duration of the presynaptic spike yielded a depolarization-release coupling plot that captures the impact of spike waveform on the initial rate of release. We conclude that accelerated release during F2 facilitation cannot be attributed to plasticity of I(Ca) or modulation of spike waveform. Kinetic analysis showed a reduction in synaptic delay during facilitation only when broad action potentials were used. In unfacilitated release, synaptic delay increased as spike duration lengthened. We propose that small single Ca(2+) channel currents during the plateau phase of broad action potentials raise local Ca(2+) concentration only enough to fill a high-affinity site. Occupation of this site in itself, or events downstream, would convert a vesicle from control to facilitated state. If the conversion were a slow process, it could explain the changes in synaptic delay reported here. This hypothesis can also account for a number of observations related to Ca(2+) cooperativity and synaptic facilitation.

Action Potentials↗
PubMed2000

Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

Amino Acid Sequence↗
PubMed2000

Regulation of AMPA receptor-mediated synaptic transmission by clathrin-dependent receptor internalization.

Redistribution of postsynaptic AMPA- (alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid-) subtype glutamate receptors may regulate synaptic strength at glutamatergic synapses, but the mediation of the redistribution is poorly understood. We show that AMPA receptors underwent clathrin-dependent endocytosis, which was accelerated by insulin in a GluR2 subunit-dependent manner. Insulin-stimulated endocytosis rapidly decreased AMPA receptor numbers in the plasma membrane, resulting in long-term depression (LTD) of AMPA receptor-mediated synaptic transmission in hippocampal CA1 neurons. Moreover, insulin-induced LTD and low-frequency stimulation-(LFS-) induced homosynaptic CA1 LTD were found to be mutually occlusive and were both blocked by inhibiting postsynaptic clathrin-mediated endocytosis. Thus, controlling postsynaptic receptor numbers through endocytosis may be an important mechanism underlying synaptic plasticity in the mammalian CNS.

Adaptor Protein Complex alpha Subunits↗
PubMed2000

Distinct molecular mechanisms and divergent endocytotic pathways of AMPA receptor internalization.

Internalization of postsynaptic AMPA receptors depresses excitatory transmission, but the underlying dynamics and mechanisms of this process are unclear. Using immunofluorescence and surface biotinylation, we characterized and quantified basal and regulated AMPA receptor endocytosis in cultured hippocampal neurons, in response to synaptic activity, AMPA and insulin. AMPA-induced AMPA receptor internalization is mediated in part by secondary activation of voltage-dependent calcium channels, and in part by ligand binding independent of receptor activation. Although both require dynamin, insulin- and AMPA-induced AMPA receptor internalization are differentially dependent on protein phosphatases and sequence determinants within the cytoplasmic tails of GluR1 and GluR2 subunits. AMPA receptors internalized in response to AMPA stimulation enter a recycling endosome system, whereas those internalized in response to insulin diverge into a distinct compartment. Thus, the molecular mechanisms and intracellular sorting of AMPA receptors are diverse, and depend on the internalizing stimulus.

Animals↗
PubMed2000

Presynaptic Ca(2+) influx at the inhibitor of the crayfish neuromuscular junction: a photometric study at a high time resolution.

Presynaptic calcium influx at the inhibitor of the crayfish neuromuscular junction was investigated by measuring fluorescence transients generated by calcium-sensitive dyes. This approach allowed us to correlate presynaptic calcium influx with transmitter release at a high time resolution. Systematic testing of the calcium indicators showed that only low-affinity dyes, with affinities in the range of micromolar, should be used to avoid saturation of dye binding and interference with transmitter release. Presynaptic calcium influx was regulated by slowly increasing the duration of the action potential through progressive block of potassium channels. The amplitude of the calcium transient, measured from a cluster of varicosities, was linearly related to the duration of the action potential with a slope of 1.2. Gradual changes in potassium channel block allowed us to estimate the calcium cooperativity of transmitter release over a 10-fold range in presynaptic calcium influx. Calcium cooperativity measured here exhibited one component with an average value of 3.1. Inspection of simultaneously recorded presynaptic calcium transients and inhibitory postsynaptic currents (IPSCs) showed that prolonged action potentials were associated with a slow rising phase of presynaptic calcium transients, which were matched by a slow rate of rise of IPSCs. The close correlation suggests that fluorescence transients provide information on the rate of calcium influx. Because there is an anatomic mismatch between the presynaptic calcium transient, measured from a cluster of varicosities, and IPSC, measured with two-electrode voltage clamp, macropatch recording was used to monitor inhibitory postsynaptic responses from the same cluster of varicosities from which the calcium transient was measured. Inhibitory postsynaptic responses recorded with the macropatch method exhibited a faster rising phase than that recorded with two-electrode voltage clamp. This difference could be attributed to slight asynchrony of transmitter release due to action potential conduction along fine branches. In conclusion, this report shows that fluorescence transients generated by calcium-sensitive dyes can provide insights to the properties of presynaptic calcium influx, and its correlation with transmitter release, at a high time resolution.

4-Aminopyridine↗
PubMed2000

Villous adenomas of the urinary tract: report of two cases.

Villous adenomas are rare tumors of the urinary tract. They are morphologically identical to their counterpart in the colon. The histogenesis and malignant potential are uncertain. We report on 2 cases, 1 each in the urethra and bladder. The first is a 57-year-old male who complained of an acute attack of urinary retention. A papillary tumor, measuring 3.0 x 2.0 cm, was found in the prostatic portion of the urethra by cystoscopy, and the tumor was removed transurethrally. The second case, a 33-year-old male, was a victim of chronic pyelonephritis with severe hydronephrosis resulting from a left renal staghorn stone. A papillary tumor was noted on the dome of the urinary bladder. The tumor, measuring 2.0 x 2.0 cm, was resected by transurethral resection. No recurrence or malignant transformation has been found during the follow-up period. The features of morphology, immunohistochemistry, and histochemistry were well studied. Staining by periodic acid-Schiff (PAS) stain, Alcian blue at pH 1.0, and Alcian blue at pH 2.5 were all positive. The carcinoembryonic antigen was strongly positive in the neoplastic glands, especially in the luminal border. We also review the previous literature and discuss the histogenesis, diagnosis, and treatment.

Adenoma, Villous↗