Biomedical subjects

Jun-ichi Sawada

Publications and source records attributed to Jun-ichi Sawada.

At least 19 recordsLinked to original sources

PubMed2007

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Adult↗

PubMed2006

Effects of polyunsaturated fatty acids on calcium response and degranulation from RBL-2H3 cells.

To investigate the biological activity of various polyunsaturated fatty acids (PUFAs) on the allergic reaction, we examined the effects of six PUFAs and two saturated fatty acids on calcium response and degranulation from rat basophilic leukemia (RBL-2H3) cells. Between 20 and 40 microM of six PUFAs (omega-6 series: arachidonic acid [AA, C20:4], gamma-linolenic acid [gamma-LN, C18:3] and linoleic acid [LA, C18:2]; omega-3 series: alpha-linolenic acids [alpha-LN, C18:3] and eicosapentaenoic acid [EPA, C20:5]; and omega-9 series: oleic acid [OLE, C18:1]), or two saturated fatty acids (stearic acid [STA, C18:0] and arachidic acid [AD, C20:0]) were used to examine the effects on calcium response and degranulation from RBL-2H3 cells. Calcium response was monitored using the fluorescent calcium indicator fura-2, while degranulation was monitored by measuring histamine release from the cells. Three omega-6 PUFAs (AA, alpha-LN and LA) dose-dependently increased the cytosolic free-calcium concentration and histamine release from RBL-2H3 cells. This phenomenon was specific to the omega-6 PUFAs, the omega-3 PUFAs (alpha-LA and EPA), omega-9 PUFA (OLE) and the saturated fatty acids (STA and AD) had no effect. The increase in the cytosolic free-calcium concentration caused by the omega-6 PUFAs depended on the existence of external calcium, cell viability and the cellular IP(3) levels remained unchanged throughout the experiment. These results suggest that omega-6 PUFAs work as direct mediators of calcium signaling pathways in RBL-2H3 cells.

Animals↗

PubMed2006

ELISA method for monitoring human serum IgE specific for Cry1Ab introduced into genetically modified corn.

Enzyme-linked immunosorbent assay (ELISA) is the most convenient method of monitoring the occurrence of IgE antibodies specific for novel proteins in genetically modified (GM) foods. The levels of IgE specific for a recombinant protein, Cry1Ab, were determined using an ELISA method. A soluble form of the Cry1Ab protein purified from pCold1 vector-transformed Escherichia coli pTf16/BL21 was used as the ELISA coating antigen, and 1M NaCl was used as the washing buffer to remove IgE non-specifically bound to the coated antigen. Sera from 44 patients allergic to major food allergens were obtained, diluted 20-fold, tested, and found no identifiable IgE above background levels. We also tested sera from patients with corn allergy against whole extracts of non-GM and GM-corn (MON 810) using immunoblotting. The staining patterns were similar for the two types of corn. These results indicate that significant levels of IgE antibodies specific to Cry1Ab were not found in the sera of Japanese patients with food allergies.

Bacillus thuringiensis Toxins↗

PubMed2006

Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer.

OBJECTIVE: Paclitaxel is one of the most important anticancer drugs for the treatment of various tumors such as non-small cell lung cancer. We investigated the association between CYP3A4 haplotypes and pharmacokinetic parameters of paclitaxel metabolism. METHODS: This study enrolled 235 Japanese patients with cancer who were receiving paclitaxel. These patients were screened for CYP3A4 gene polymorphisms by either direct sequencing or pyrosequencing. Plasma concentrations of paclitaxel and its 3 metabolites were determined by HPLC in 229 patients. RESULTS: Median values of paclitaxel clearance, normalized for body surface area, were lower in the high-dose group (>or=175 mg/m2, n = 199) than in the low-dose group (<or=100 mg/m2, n = 30), suggesting nonlinearity of pharmacokinetics caused by Cremophor EL. Therefore we mainly used the patients in the high-dose group for further analysis. The median value of the area under the curve (AUC) ratio of 3'-p-hydroxypaclitaxel to paclitaxel was 20% greater (95% confidence interval, 2.4% to 41.7%) in the women than in the men (P = .01). Although no significant difference in paclitaxel clearance was observed among the CYP3A4 haplotypes, 16B-bearing (1/16B) patients (n = 8) showed a 20% lower (95% confidence interval, -58.5 to -11.5%) median AUC ratio of 3'-p-hydroxypaclitaxel to paclitaxel (P = .04) and a 2.4-fold higher median AUC ratio of 6alpha-hydroxypaclitaxel to paclitaxel (P < .001) compaed with those in the wild-type (1/1) patients (n = 180). In contrast, no significant differences were seen between 1/1 and 18B/1 (n = 10) patients for the pharmacokinetic parameters examined. CONCLUSIONS: Our results suggest that CYP3A416B is associated with both reduced 3'-p-hydroxylation of paclitaxel and probably increased levels of 6alpha-hydroxypaclitaxel.

Adult↗

PubMed2006

Molecular cloning of cDNA, recombinant protein expression and characterization of a buckwheat 16-kDa major allergen.

BACKGROUND: Buckwheat is a common food in Japan, Korea and other countries. A candidate major buckwheat allergen, a 16-kDa protein (BWp16), was previously characterized as a pepsin-resistant protein associated with immediate-type allergies to buckwheat. However, whether recombinant BWp16 can react with a patient's IgE remains uncertain. METHODS: The cDNA encoding BWp16 from Japanese buckwheat seeds was cloned based on the sequences obtained by the 5'-rapid amplification of cDNA ends (RACE) and 3'-RACE PCR. Recombinant BWp16 protein expressed in Escherichia coli was purified using affinity chromatography. Western blotting, ELISA and cross inhibition tests of the purified recombinant BWp16 were performed using sera from patients with positive IgE binding to buckwheat and controls. Pepsin digestion experiments were also performed. RESULTS: The full-length cDNA encodes 149 amino acid residues with a calculated molecular mass of 16.9 kDa. The deduced amino acid sequence included a putative signal peptide sequence. BWp16 showed significant homologies to the buckwheat 8-kDa allergen and Ricinus communis (castor bean) 2S albumin. Sera from patients with positive IgE binding to buckwheat reacted with the purified BWp16. Cross inhibition tests revealed immunological equivalence of the purified recombinant and natural BWp16. The recombinant and natural BWp16 were comparably resistant to pepsin digestion. CONCLUSIONS: BWp16 belongs to the 2S albumin family and is a buckwheat allergen. This purified recombinant BWp16 could be used in the diagnosis of buckwheat allergy.

Allergens↗

PubMed2006

Profile analysis and immunoglobulin E reactivity of wheat protein hydrolysates.

BACKGROUND: Wheat protein hydrolysates have been traditionally used as food additives and are now being used in cooking worldwide. There have been a few studies on the relationship between the molecular mass distribution and the immunoglobulin E (IgE) reactivity of the wheat protein hydrolysates. METHOD: We analyzed the peptide profile of commercial wheat protein hydrolysate samples from enzymatic or acid hydrolysis of wheat protein using size exclusion chromatography. We further investigated the IgE reactivity of the wheat protein hydrolysates using the inhibition ELISA method and sera of 5 patients sensitive to wheat. RESULTS: The wheat protein enzymatic hydrolysate samples showed high concentrations of peptides with molecular masses greater than 1,050 Da, whereas in contrast, the wheat protein acid hydrolysates showed extremely low concentrations of peptides with molecular masses greater than 1,050 Da. Tested wheat protein acid hydrolysates hardly inhibited the patient IgE binding ability to wheat proteins in the five patient sera. On the contrary, some tested wheat protein enzymatic hydrolysate samples inhibited the IgE binding ability to wheat proteins. CONCLUSION: These results suggested that the uptake of wheat protein enzymatic hydrolysates might still have the possibility of causing food allergic reactions in patients allergic to wheat and the processed foods containing them.

Binding Sites, Antibody↗

PubMed2006

Catalytic roles of CYP2D6.10 and CYP2D6.36 enzymes in mexiletine metabolism: in vitro functional analysis of recombinant proteins expressed in Saccharomyces cerevisiae.

Cytochrome P450 2D6 (CYP2D6) metabolizes approximately one-third of the medicines in current clinical use and exhibits genetic polymorphism with interindividual differences in metabolic activity. To precisely investigate the effect of CYP2D6*10B and CYP2D6*36 frequently found in Oriental populations on mexiletine metabolism in vitro, CYP2D6 proteins of wild-type (CYP2D6.1) and variants (CYP2D6.10 and CYP2D6.36) were heterologously expressed in yeast cells and their mexiletine p- and 2-methyl hydroxylation activities were determined. Both variant CYP2D6 enzymes showed a drastic reduction of CYP2D6 holo- and apoproteins compared with those of CYP2D6.1. Mexiletine p- and 2-methyl hydroxylation activities on the basis of the microsomal protein level at the single substrate concentration (100 microM) of variant CYP2D6s were less than 6% for CYP2D6.10 and 1% for CYP2D6.36 of those of CYP2D6.1. Kinetic analysis for mexiletine hydroxylation revealed that the affinity toward mexiletine of CYP2D6.10 and CYP2D6.36 was reduced by amino acid substitutions. The Vmax and Vmax/Km values of CYP2D6.10 on the basis of the microsomal protein level were reduced to less than 10% of those of CYP2D6.1, whereas the values on the basis of functional CYP2D6 level were comparable to those of CYP2D6.1. Although it was impossible to estimate the kinetic parameters for the mexiletine hydroxylation of CYP2D6.36, the metabolic ability toward mexiletine was considered to be poorer not only than that of CYP2D6.1 but also than that of CYP2D6.10. The same tendency was also observed in kinetic analysis for bufuralol 1''-hydroxylation as a representative CYP2D6 probe. These findings suggest that CYP2D6*36 has a more drastic impact on mexiletine metabolism than CYP2D6*10.

Anti-Arrhythmia Agents↗

PubMed2006

Identification of regulatory sites in the human PXR (NR1I2) promoter region.

The human pregnane X receptor (hPXR, NR1I2) is a member of the nuclear receptor superfamily and a key regulator of genes encoding several major cytochrome P450 enzymes and transporters. However, the transcriptional regulation of hPXR itself remains unclear. We recently reported significant diversity in the 5' region of human hepatic PXR transcripts and identified the major transcription initiation site. Here, we investigate the transcriptional regulatory sites in the hPXR 5'-flanking region. Luciferase reporter constructs containing various lengths of 5'-flanking region, up to 10.5 kb upstream of the major transcription initiation site, were assessed for promoter activity in HepG2 cells. We mapped the minimal essential region for promoter activity to a 160 bp region upstream of the transcription initiation site, an area that also showed nuclear protein binding. Constructs with mutations introduced into these protein-binding sites demonstrated reduced promoter activity concomitant with reduced DNA-protein binding activity. hPXR promoter activity was observed in HepG2 cells but not in HeLa cells. Likewise, nuclear protein binding to promoter elements was also observed in HepG2 but not HeLa cells. The present study provides basic information on the transcriptional regulation of hPXR and may help elucidate the regulatory mechanisms of hPXR target genes.

5' Flanking Region↗

PubMed2006

Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese.

Genetic variations in cytochrome P450 2C9 (CYP2C9) are known to contribute to interindividual and interethnic variability in response to clinical drugs such as warfarin. In the present study, CYP2C9 from 263 Japanese subjects was resequenced, resulting in the discovery of 62 variations including 32 novel ones. In addition to the two known non-synonymous single nucleotide polymorphisms (SNPs), Ile359Leu (*3; allele frequency=0.030) and Leu90Pro (*13; 0.002), seven novel non-synonymous SNPs, Leu17Ile (0.002), Lys118ArgfsX9 (*25; 0.002), Thr130Arg (*26; 0.002), Arg150Leu (*27; 0.004), Gln214Leu (*28; 0.002), Pro279Thr (*29; 0.002) and Ala477Thr (*30; 0.002), were found. Functional characterization of novel alleles using a mammalian cell expression system in vitro revealed that *25 was a null allele and that *26, *28 and *30 were defective alleles. The *26 product showed a 90% decrease in the Vmax value but little change in the Km value towards diclofenac. Both *28 and *30 products showed two-fold higher Km values and three-fold lower Vmax values than the *1 allele, suggesting the importance of Gln214 and Ala477 for substrate recognition. Linkage disequilibrium and haplotype analyses were performed using the detected variations. Only five haplotypes (frequency >0.02) accounted for most (>87%) of the inferred haplotypes, and they were closely associated with the haplotypes of CYP2C19 in Japanese. Although the haplotype structure of CYP2C9 was rather simple in Japanese, the haplotype distribution was quite different from those previously reported in Caucasians and Africans. Taken together, novel defective alleles and detailed haplotype structures would be useful for determining metabolic phenotypes of CYP2C9 substrate drugs in Japanese and probably Asians.

Alleles↗

PubMed2006

A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.

The human multidrug resistance gene 1 (MDR1) encodes a plasma membrane P-glycoprotein (P-gp) that functions as an efflux pump for various structurally unrelated anticancer agents. We have identified two nonsynonymous germ-line mutations of the MDR1 gene, C3583T MDR1 and T3587G MDR1, in peripheral blood cell samples from Japanese cancer patients. Two patients carried the C3583T MDR1 allele that encodes H1195Y P-gp, whereas a further two carried T3587G MDR1 that encodes I1196S P-gp. Murine NIH3T3 cells were transfected with pCAL-MDR-IRES-ZEO constructs carrying either wild-type (WT), C3583T, or T3587G MDR1 cDNA and selected with zeocin. The resulting zeocin-resistant mixed populations of transfected cells were designated as 3T3/WT, 3T3/H1195Y, and 3T3/I1196S, respectively. The cell surface expression of I1196S P-gp in 3T3/I1196S cells could not be detected by fluorescence-activated cell sorting, although low expression of I1196S P-gp was found by Western blotting. H1195Y P-gp expression levels in 3T3/H1195Y cells were slightly lower than the corresponding WT P-gp levels in 3T3/WT cells. By immunoblotting analysis, both WT P-gp and H1195Y P-gp were detectable as a 145-kDa protein, whereas I1196S P-gp was visualized as a 140-kDa protein. 3T3/I1196S cells did not show any drug resistance unlike 3T3/H1195Y cells. Moreover, a vanadate-trap assay showed that the I1196S P-gp species lacks ATP-binding activity. Taken together, we conclude from these data that T3587G MDR1 expresses a nonfunctional P-gp and this is therefore the first description of such a germ-line mutation. We contend that the T3587G MDR1 mutation may affect the pharmacokinetics of MDR1-related anticancer agents in patients carrying this allele.

3T3 Cells↗

PubMed2006

Gene expression property of high-density three-dimensional tissue of HepG2 cells formed in radial-flow bioreactor.

In our previous study, we examined three-dimensional culture using 5-ml radial-flow bioreactor (RFB) and showed that genes encoding cell cycle related proteins were suppressed in a stable phase. In this study, we analyzed the gene expression profiles of RFB-cultivated HepG2 cells and found that vascular endothelial growth factor (VEGF) production was strongly induced in the stable phase compared with the growth phase or static two-dimensional culture. When human umbilical vein endothelial cells (HUVECs) were grown under the conditioned medium of the stable phase, it was found that the formation of new blood vessels was induced in the angiogenesis model. DNA microarray analysis showed that the expression levels of both genes related to cell cycle arrest and which are known as tumor markers have increased in the stable phase. This result suggests that HepG2 cells in the stable phase maintain an active tumor phenotype. In addition, the expression of genes induced in the hypoxic condition was also induced in the stable phase. When the culture was carried out under a higher dissolved oxygen (DO) concentration, VEGF production did not decrease significantly and the new blood-vessel-forming ability of the conditioned medium was not suppressed. This suggests that the induction of VEGF production in a stable phase is not affected by DO during the tested level. These results suggest that the RFB cell culture system may be used to assess tumor progression mechanism under three-dimensional condition in vitro.

Biomarkers, Tumor↗

PubMed2006

Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

ATP Binding Cassette Transporter, Subfamily G, Mem↗

PubMed2006

Sequence-based analysis of the CYP2D636-CYP2D610 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population.

The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch(2)-Ch(1) (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project.

3' Flanking Region↗

PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

PubMed2006

Diverse structures of chimeric CYP-REP7/6-containing CYP2D6 and a novel defective CYP2D6 haplotype harboring single-type *36 and CYP-REP7/6 in Japanese.

Chimeric REP7/6 has been used as a marker of CYP2D6 deletion, such as for CYP2D6*5. However, the CYP2D6*10D (*10D) haplotype found in a Japanese population consist of CYP2D6*10B, CYP2D7P-derived 3'-flanking region, and a chimeric repetitive sequence, CYP-REP7/6 (REP7/6) (Ishiguro et al. Clin. Chim. Acta. 2004: 347, 217-221). From our analysis, REP7/6 was found in 26 out of 254 Japanese subjects. Thus, the REP7/6-containing CYP2D6 genes (2D6-REP7/6) were analyzed in detail. In order to specifically detect the 2D6-REP7/6 structure, primers were designed in CYP2D6 intron 6 and the REP7/6 3'-flanking region. Among 26 subjects analyzed by PCR, 5 had 2D6-REP7/6. The other 21 subjects were confirmed to have *5 by another *5-specific primer set. Three out of five subjects with 2D6-REP7/6 had the *10D structure. However, further analysis by PCR and sequencing revealed that their haplotypes were further divided into tandem-type *36-*10D (n=2) and single-type *10D (n=1). The remaining two subjects had a novel type of a *36-containing defective structure that consists of CYP2D6*36 and 3'-flanking REP7/6 (single-type *36-REP7/6). Then, REP7/6 sequences in *5, *10D, *36-*10D, and single-type *36 were determined and classified into 5 types: types A to D for *5, type E for *10D and *36-*10D, and type F for *36. These findings could be useful for accurate determination of *5 and REP7/6-harboring aberrant CYP2D6 haplotypes.

Asian People↗

PubMed2006

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS).

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

3' Untranslated Regions↗

PubMed2006

Effect of oral administration of CpG ODN-OVA on WBB6F1-W/Wv mice.

BACKGROUND: We have already reported that antigen-specific IgG1 antibody production in WBB6F1-W/Wv (W/Wv) mice after oral administration of ovalbumin (OVA) was extremely high. Active systemic anaphylaxis (ASA) was induced in these mice after intraperitoneal (i.p.) administration of OVA, and Th2-dominant helper T-cell activation occurred. In this study, we examined the effect of CpG oligodeoxynucleotide (ODN) conjugation of OVA on oral immunization of W/Wv mice. METHODS: W/Wv mice were sensitized by administration of 0.1 mg OVA or CpG ODN-OVA by gavage every day for 4 weeks, and the serum titers of OVA-specific IgG1, IgE, and IgG2a antibody were determined. ASA was induced by i.p. injection of OVA, and the changes in body temperature were monitored. In vitro production of Th1- and Th2- type cytokines by splenocytes re-stimulated with antigen was also measured. RESULTS: The antigen-specific IgG1 antibody titer in the CpG ODN-OVA-sensitized W/Wv mice was lower than in the OVA-sensitized group, but the IgG2a titer was higher. ASA was not induced by i.p. OVA challenge. There were significant increases in the production of Th1-type cytokine (IFN-gamma) by splenocytes in the CpG ODN-OVA-sensitized mice, but the Th2-type cytokine (IL-4) level in the splenocyte culture medium was lower. CONCLUSIONS: These results indicated that oral administration of CpG ODN-OVA conjugate significantly induced antigen-specific Th1 responses and reduced Th2 responses (allergic reactions) on re-stimulation. These findings suggest that CpG ODN-antigen conjugate may be useful as an oral vaccine.

Administration, Oral↗

PubMed2006

A detection method of CryIAc protein for identifying genetically modified rice using the lateral flow strip assay.

We examined the lateral flow strip assay for identifying unauthorized genetically modified (GM) rice. The GM rice expresses the Bacillus thuringiensis (Bt) toxin, CryIAc protein, which confers tolerance to insects. The recombinant CryIAc protein was prepared from the inclusion bodies of an E. coli. strain into which the CryIAc gene had been inserted, using gel filtration chromatography. The lateral flow strip assay for the identification of GM cotton which also expresses CryIAc protein, was applied to unpolished rice and polished rice spiked with recombinant CryIAc protein. The spiked recombinant CryIAc protein was clearly detected at the level of 0.012 microg/g in both the unpolished and polished rice. After loading of the extract on the strip, a 60 -minute stand time is necessary to clearly detect CryIAc protein. The detection limit was approximately 12 ng CryIAc protein per gram of rice. These results suggest that the lateral flow strip assay for GM cotton can be used to detect CryIAc protein expressed in GM rice.

Bacillus thuringiensis Toxins↗