PubMed Health⌕ Search

Biomedical subjects

K Hama

Publications and source records attributed to K Hama.

At least 19 recordsLinked to original sources
PubMed2006

The role of plasmapheresis therapy for perioperative management in ABO-incompatible adult living donor liver transplantation.

BACKGROUND: Although living donor liver transplantation (LDLT) was established as a treatment for end-stage liver disease in Japan, the indication for LDLT across an ABO-incompatible barrier remains controversial. The purpose of this study was to elucidate the role of plasmapheresis in incompatible LDLT. METHODS: Eleven adult patients (seven men and four women) who underwent incompatible LDLT were enrolled in this study. Of these three patients had hepatocellular carcinoma, three chronic hepatitis C, one Wilson's disease, one autoimmune hepatitis, one chronic hepatitis B, one hemochromatosis, and one fulminant hepatic failure. The immunosuppressive regimen consisted of tacrolimus, prednisolone, mycophenolate mofetil (or cyclophosphamide), and prostaglandin E1 in all patients. Multiple plasmapheresis was performed perioperatively to reduce the recipient's antibody titers against the donor's blood type. RESULTS: Plasmapheresis was useful for the reduction of the recipient's antibody titers to x 16 or lower before and after transplantation. There was no difference in transplant outcome between the 11 patients with incompatible blood group and 30 patients with identical or compatible blood groups. DISCUSSION: Major postoperative complications such as intrahepatic biliary complications and hepatic necrosis may occur in incompatible transplantation. Several investigators suggested that anti-immunoglobulin (Ig) M and anti-IgG antibody titers sustained these complications. The antibody titers must be decreased sufficiently with plasmapheresis. An elevation of anti-ABO titers after transplantation may be a predictive risk factor for increased mortality and morbidity. In order to perform LDLT in a safer manner, plasmapheresis is an indispensable treatment to improve the outcome of ABO-incompatible cases.

ABO Blood-Group System↗
PubMed2005

Optimal dose and target trough level in cyclosporine and tacrolimus conversion in renal transplantation as evaluated by lymphocyte drug sensitivity and pharmacokinetic parameters.

We evaluated the relative clinical potency of cyclosporine (CyA) and tacrolimus (Tac) using pharmacodynamic and pharmacokinetic parameters of the drug to obtain the most suitable converting dose and target trough level. The relative pharmacodynamic potency was examined by the mean ratio of drug concentrations giving 50% inhibition of blastogenesis of lymphocytes (IC50) in 66 chronic renal failure patients. The relative potency estimated from clinical pharmacokinetic parameters was examined by the mean ratio of each pharmacokinetic parameter value of CyA versus Tac. The pharmacokinetic parameters were estimated by 12-hour monitoring of drug blood concentrations in seven CyA patients and seven Tac patients. The mean IC50 ratio of CyA and Tac (CyA/Tac of IC50) was 25.1. The mean area under the concentration-time curve (AUC) ratio (CyA/Tac of AUC) was 25.5, the mean trough level (C(min)) ratio (CyA/Tac of C(min)) was 13.2, and the mean dose per body weight ratio was 25.2. The relative potency estimated from AUC that is the most reliable pharmacokinetic parameter for the estimation of clinical efficacy of calcineurin inhibitors appeared to agree with the relative pharmacodynamic potency estimated from IC50. The data suggest that TAC 25-fold more potent than CyA, which represents a suitable converting dose ratio, and that target trough level of CyA is about 13-fold greater than Tac based on CyA/Tac of C(min). We conclude that these relative values may be useful to estimate the suitable dose and target trough levels to convert between CyA and Tac.

Area Under Curve↗
PubMed2005

Evaluation of appropriate blood level in continuous intravenous infusion from trough concentrations after oral administration based on area under trough level in tacrolimus and cyclosporine therapy.

The target blood concentrations of tacrolimus (TAC) and cyclosporine (CYA) during continuous intravenous infusion (C(ss)) have been determined based on clinical experience. However, it is desirable that C(ss) should be set so that the AUC after intravenous infusion is equal to the AUC after oral administration (AUC(po)). Accordingly, we performed 12-hour monitoring of blood concentrations to calculate C(ss) from the blood trough levels (C(TL)) on 15 kidney recipients administered TAC and 12 recipients administered CYA (Neoral). We used an area under the trough level (AUTL) as a new pharmacokinetic parameter. The C(ss) was evaluated from C(TL), AUC(po), and AUTL was calculated to be C(ss) = C(TL) x (AUC(po)/AUTL). In addition, AUTL/AUC(po) ratio and blood peak/trough level ratio (C(max)/C(min)) were examined to compare pharmacokinetics of TAC and CYA. The formula for TAC was C(ss) = C(TL) x 1.40 and that for CYA, C(ss) = C(TL) x 2.55. The calculated target C(ss) of TAC was 1.40 times that of C(TL), which was similar to the present clinical C(TL). In contrast, the calculated target C(ss) of CYA was 2.55 times the C(TL), and therefore an extremely high C(ss) was necessary to obtain a sufficient AUC that will be available after oral administration. Consequently, intravenous administration of CYA twice a day was considered to be more appropriate to obtain sufficient CYA pharmacokinetics, rather than a continuous intravenous administration. We conclude that the formula, C(ss) = C(TL) x (AUC(po)/AUTL) was useful to calculate the target blood concentration of calcineurin inhibitors when changing from continuous intravenous infusion to oral administration of these drugs.

Administration, Oral↗
PubMed2005

Pharmacokinetic differences between morning and evening administration of cyclosporine and tacrolimus therapy.

We performed 24-hour monitoring of cyclosporine (NEO) and tacrolimus (TAC) blood concentrations, evaluating pharmacokinetic parameters and characterizing circadian variations. The monitoring was performed in 10 instances on nine patients administered NEO and 12 out of 11 patients administered TAC. All cases were administered equally divided doses of drugs twice daily orally. Blood samples were taken before and 1, 2, 3, 4, 6, and 12 hours after NEO or TAC administration in the morning and evening. The pharmacokinetic parameters were compared between morning and evening administrations of both drugs. AUC0-12, AUC0-4, C(max), C2, and C(max)/C(min) of NEO and TAC were significantly lower during the evening compared with morning administrations. C(min) values were significantly higher in the evening. T(max) of NEO was longer in evening, although there was not a significant difference; T(max) of TAC was significantly longer in the evening. We found that NEO and TAC administrations in the evening resulted in reduced bioavailability and delayed absorption when compared with drug administrations in the morning. It was thought that the difference in bioavailability between morning and evening administrations was smaller with TAC, because TAC shows lower peak levels and a flatter blood concentration curve than NEO. C(min) was higher after evening administration than morning because of delayed absorption, though the bioavailability of both drugs decreased in the evening. These results suggest that we have to appreciate apparently high trough levels.

Administration, Oral↗
PubMed2005

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗
PubMed2004

Successful case of adult ABO-incompatible liver transplantation: beneficial effects of intrahepatic artery infusion therapy: a case report.

BACKGROUND: In Japan ABO-incompatible liver transplantation has been done on >100 occasions up to 2003. However, <30% are cases involving adults. The difficultly of ABO-incompatible liver transplantation is associated with the high frequency of humoral rejection and local disseminated intravascular coagulation (DIC), leading to many postoperative complications. We report a successful case of adult ABO-incompatible liver transplantation with the use of an intrahepatic artery infusion. METHODS: A 36-year-old man with Wilson disease, underwent living donor liver transplantation from an ABO-incompatible donor. The immunosuppressive therapy included multiple perioperative plasmaphereses, splenectomy, and treatment with tacrolimus, methylprednisolone, and cyclophosphamide. The dose and blood level of tacrolimus were the same as in ABO-compatible cases. In addition to these therapies, we administered an intrahepatic arterial infusion with prostaglandin (PG) E1 alone. RESULTS: After perioperative plasmapheresis and cyclophosphamide, antidonor blood group antibody titers remained undiluted and without vascular complications throughout the postoperative course, but there was a tendency for bleeding that continued for 10 days after transplantation. On postoperative day 10, a reexploration was performed for intraabdominal bleeding. During another operation on postoperative day 59 a biloma was found and drained. The patient has now survived for 120 days after transplantation with normal liver function. CONCLUSIONS: Beneficial effect of intrahepatic artery infusion with PGE1 seems to be useful in adult ABO-incompatible liver transplantation.

ABO Blood-Group System↗
PubMed2001

Changes of cytokines in direct endotoxin adsorption treatment on postoperative multiple organ failure.

Multiple organ failure (MOF) is a serious condition that involves simultaneous or consecutive functional failure of several important organs. Furthermore, sepsis is known to play an important role in the occurrence of MOF. Hemoadsorption therapy with the endotoxin adsorption column containing polymyxin B immobilized fibers by direct hemoperfusion (PMX-DHP) is reportedly effective in the treatment of septic shock. This study examined the changes induced on cytokines upon PMX-DHP treatment in 25 patients who underwent emergency abdominal surgery and were immediately started on a postoperative regimen of continuous hemodiafiltration (CHDF) and PMX-DHP. Postoperative MOF was observed in these patients with a mean APACHE II SCORE of 25.5. Eighty percent of patients survived for more than 1 month. We were able to reduce the necessary dose of dopamine in 85.7% of patients because hemodynamic stability improved after administration of PMX-DHP. Interleukin 6 blood levels did not change significantly before or after PMX-DHP treatment in either the surviving or nonsurviving patients. Blood interleukin 1 receptor antagonist levels decreased in both groups. Intercellular adhesion molecular-1, NOx, and thrombomodulin did not change significantly during the course of treatment in either group. Decreased blood levels of PAI-1 levels were found in the surviving patients whereas increased levels of PAI-1 were found in the non-surviving patients. In conclusion, PMX-DHP treatment may be limited clinically in its ability to remove inflammatory cytokines and humoral mediators. However, PMX-DHP treatment is useful for hemodynamic stabilization, which prevents development of MOF.

APACHE↗
PubMed2000

High-voltage electron microscopy in neurocytology.

The function of the living matter from biomolecules to the whole body of the organism is based on the structure. Consequently, structural information is essential for the understanding of the function of living organisms. The biological structures from biomolecules to cells and tissues are intimately related to each other, and changing their morphological, biochemical, and physiological properties dynamically according to the developmental and functional status of the organism. The molecular dynamics of living matter should be related to the function of whole body. We employed HVEM stereoscopy and morphometry for the purpose of combining the structural information at nanometer level with those of the micrometer level. Novel aspects of three-dimensional organization of neuronal and glial cell processes have been presented. This structural information together with morphometrical data could contribute to the elucidation of brain function.

Animals↗
PubMed1999

Influence of filler content and gap dimension on wear resistance of resin composite luting cements around a CAD/CAM ceramic inlay restoration.

We investigated the influence of filler content and gap dimension on the wear resistance of composite luting cement around CAD/CAM ceramic inlay restorations. Experimental hybrid dual-cured composite luting cements containing 60, 70, 72, 74 and 80 wt% of silanated barium-silica fillers were used for cementing CAD/CAM ceramic inlay into the cavity. The specimens involving inlay-cement-tooth interfaces were subjected to a three-body wear test. The relation between the interfacial gap dimension and wear loss was also investigated using 60, 70 and 80 wt% filled cements. The cements containing more than 70 wt% filler presented significantly higher wear resistance than 60 wt% filled cement. There was a positive linear relationship between gap dimension and wear loss, and the inclination of the regression line decreased with increasing filler content. These results indicated that the higher filler content of the cement increased the wear resistance and this desirable influence appeared more remarkably in the wider horizontal gap dimension.

Analysis of Variance↗