PubMed Health⌕ Search

Biomedical subjects

K Hosono

Publications and source records attributed to K Hosono.

At least 37 records · Page 2Linked to original sources
PubMed1996

Hairpin antisense oligonucleotides containing 2'-methoxynucleosides with base-pairing in the stem region at the 3'-end: penetration, localization, and Anti-HIV activity.

Hairpin antisense oligodeoxyribonucleotides containing 2'-methoxynucleosides were more active in the micromolar concentration range than linear and DNA hairpin phosphorothioate oligonucleotides with the same sequence. Furthermore, the abilities of hairpin antisense and random hairpin phosphorothioate oligonucleotides to inhibit HIV-1 replication were examined. Antisense oligonucleotides inhibit the replication and the expression of HIV-1 more efficiently than random-oligomers of the same length or with the same internucleotide modification. Four different target sites (gag, pol, rev, and tat) within the HIV-1 genome were studied with regard to the inhibition of HIV-1 replication by antisense oligonucleotides. Antisense oligomers complementary to the sites of the initiation sequences of gag were most effective. The [32P]-labeled hairpin phosphorothioate oligonucleotide was rapidly assimilated by MOLT-4 cells, whereas the [32P]-labeled hairpin phosphodiester oligonucleotide was not. In MOLT-4 cells treated with the FITC-hairpin phosphorothioate oligonucleotide containing 2'-methoxynucleosides by a confocal laser scanning microscope, diffuse fluorescence was observed in the cytoplasm. Interestingly, fluorescent signals accumulated in the nuclear region of chronically infected MOLT-4/HIV-1 cells after a 60 min incubation.

Antiviral Agents↗
PubMed1996

[Evaluation of non-uniform attenuation correction using simultaneous transmission and emission computed tomography--basic analysis with myocardial phantom].

Simultaneous transmission emission protocol (STEP), developed for the non-uniform attenuation correction of single photon emission computed tomography (SPECT) was evaluated using the cardiac phantom prepared with and without a myocardial wall defect. Emission computed tomography (ECT) of the cardiac phantom using 201Tl was acquired. Transmission data (TCT) were taken using a line source of 99mTc. Myocardial images with STEP method were superior in the homogeneity of intramyocardial radioactivity and spatial resolution to the conventional SPECT images. This is an excellent method because of the accurate matching position between TCT and ECT images and shortening the examination time by simultaneous data acquisition. It would be clinically useful for diagnosing various myocardial diseases.

Heart↗
PubMed1995

Properties of base-pairing in the stem region of hairpin antisense oligonucleotides containing 2'-methoxynucleosides.

We have designed a new type of antisense oligodeoxyribonucleotide. These oligonucleotides are able to form hairpin loop structures at the 3'-ends. The stability to nuclease degradation was observed by incubation of these hairpin oligonucleotides with snake venom phosphodiesterase, DNA polymerase, and fetal bovine serum. Of particular interest is the hairpin antisense oligonucleotide containing 2'-methoxynucleosides with base-pairing in the stem region at the 3'-end, which has increased nuclease resistance.

Base Composition↗
PubMed1995

Decreasing accumulation of acetate in a rich medium by Escherichia coli on introduction of genes on a multicopy plasmid.

Escherichia coli excretes acetate during aerobic growth in a rich medium, L-broth containing 0.4% glucose, and growth ceases before depletion of glucose because of the decrease in pH caused by the accumulation of acetate. The addition of sodium phosphate buffer to the medium allows cells to reuse the acetate accumulated. Reuse of the acetate, however, does not occur in the presence of remaining glucose. A gene on a multicopy plasmid was found to significantly decrease the accumulation of acetate by the transformant and the growth did not cease until depletion of both the glucose and acetate in the medium. The gene was tentatively named mlc (making large colonies). The putative Mlc protein has high hology with the NagC protein, which is a regulator protein in the nag operon responsible for the use of N-acetylglucosamine. The nagC gene on a multicopy plasmid also decreased the accumulation of acetate. Although the function of the genes in the phenomenon described is still unclear, transformants harboring the mlc gene or nagC gene on a multicopy plasmid will be useful for condensed cultivations involving glucose.

Acetates↗
PubMed1995

Selective deuteration of RNA for NMR signal assignment.

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.

Base Sequence↗
PubMed1995

Properties of nicked and circular dumbbell RNA-DNA chimeric oligonucleotides.

We have designed a new type of antisense oligodeoxyribonucleotide. These oligonucleotides form two hairpin loop structures with RNA-DNA base pairs (sense (RNA) and antisense (DNA)) in the double helical stem. The nicked and circular dumbbell RNA/DNA chimeric oligonucleotides are molecules, with or without free ends, that are more resistant to exonuclease attack. Of particular interest, antisense DNA is liberated by RNase H treatment of the dumbbell RNA/DNA chimeric oligonucleotides.

Base Sequence↗
PubMed1994

Purification and some properties of a novel racemase, which racemizes 2-oxothiazolidine-4-carboxylic acid and 5-oxoproline, from Flectobacillus sp. strain B-1.

A novel racemase active toward 2-oxothiazolidine-4-carboxylic acid was purified 310-fold with 5% recovery to near homogeneity from a crude extract of Flectobacillus sp. B-1, which had been isolated as a bacterium being able to assimilate (S)-2-oxothiazolidine-4-carboxylic acid. The molecular weight was estimated to be 92,000 by gel filtration. The purified preparation migrated as a single band of molecular weight 49,000 upon SDS-polyacrylamide gel electrophoresis. The enzyme exhibited maximum activity at pH 8.0 and 45 degrees C. The enzyme also racemized 5-oxoproline but did not act on proline and 4-hydroxyproline. The enzyme apparently had no coenzyme requirement. The enzyme activity was inhibited to 62-100% by SH-blocking reagents such as HgCl2, AgNO3, PCMB, iodoacetamide, N-ethylmaleimide and N-bromosuccinimide.

Bacillus↗
PubMed1994

Identification and characterization of the ackA (acetate kinase A)-pta (phosphotransacetylase) operon and complementation analysis of acetate utilization by an ackA-pta deletion mutant of Escherichia coli.

The pta gene encoding phosphotransacetylase was cloned on a high copy plasmid with or without the ackA gene encoding acetate kinase in Escherichia coli. The acetate kinase and phosphotransacetylase were overproduced in cells harboring the plasmid possessing both genes. Nucleotide sequencing of the pta gene revealed that it is able to produce a polypeptide comprising 714 amino acid residues, which starts at 70 base pairs downstream from the stop codon of the ackA gene. The 77-kDa protein band of overproduced phosphotransacetylase was observed on SDS-polyacrylamide gel electrophoresis, of which the amino terminal sequence corresponds to that of the deduced polypeptide without the amino terminal methionine. Two transcripts of pta of different sizes were found in the cells. A 3,700 nucleotide transcript, which covers the ackA and pta genes, seemed to be produced by the first promoter in the operon and a 2,300 nucleotide transcript, which covers just pta, seemed to be produced by the second promoter. In a synthetic medium containing acetate as the sole carbon source, the growth of an ackA-pta double mutant was greatly impaired. Complementation analyses revealed that both the acetate kinase and phosphotransacetylase were required for the rapid growth in the acetate medium.

Acetate Kinase↗
PubMed1994

Identification of causative chemicals of allergic contact dermatitis using a combination of patch testing in patients and chemical analysis. Application to cases from rubber gloves.

5 cases of allergic contact dermatitis from rubber gloves were investigated by our recommended procedures using a combination of patch testing in patients and chemical analysis of causative rubber products by gas chromatography (GC) and high-performance liquid chromatography (HPLC). We previously confirmed that zinc ethylphenyldithiocarbamate (ZEPC), a dithiocarbamae-type accelerator (DTC), was causative in a case of allergic contact dermatitis from rubber work gloves. Subsequently, we have clarified that DTCs such as zinc dimethyldithiocarbamate (ZDMC), zinc diethyldithiocarbamate (ZDEC) and zinc dibutyldithiocarbamate (ZDBC) and amines such as dimethylamine (DMA), diethylamine (DEA) and piperidine (PIP) were also causative in cases from surgical rubber gloves. Thus, our investigative studies revealed that, although thiurams have been taken much more notice of as allergenic compounds than their corresponding DTCs and amines, not only DTCs such as ZDMC, ZDEC, ZDBC and ZEPC, but also amines such as DMA, DEA and PIP were noteworthy causative candidates of allergic contact dermatitis from rubber gloves.

Adult↗
PubMed1994

Construction of Pta-Ack pathway deletion mutants of Escherichia coli and characteristic growth profiles of the mutants in a rich medium.

Escherichia coli grown in a rich medium excreted acetate and reused the acetate. Using cloned genes and a plasmid with a temperature-sensitive replication origin, three kinds of Pta-Ack pathway deletion mutants were constructed. Acetate production and reuse by wild-type cells grown in the rich medium was confirmed to largely occur through the Pta-Ack pathway. The deletion mutants of the gene encoding phosphotransacetylase secreted pyruvate before the secretion of acetate into the medium. A deletion mutant of the gene encoding acetate kinase grew at a slow rate, but its secretion and use of acetate were rapid. These results indicated that a pathway(s), other than the Pta-Ack pathway, functions in the control of excess carbon flow in the mutants.

Acetate Kinase↗
PubMed1993

[A case of pulmonary alveolar proteinosis--evaluation of a Swan-Ganz catheter in bilateral lung lavage].

Lung lavage, known to be effective for alveolar proteinosis, brings about significant hypoxemia immediately after evacuation of lavage fluid. Impeding blood flow of even a distal branch of a pulmonary artery by using a Swan-Ganz catheter (SGC) successfully prevented this hypoxemia. And this SGC procedure could be safely carried out to make lavage of each lung successively in one day.

Adult↗