Biomedical subjects

K Lechner

Publications and source records attributed to K Lechner.

At least 199 records · Page 11Linked to original sources

PubMed1994

Effective stimulation of neutropoiesis with rh G-CSF in dyskeratosis congenita: a case report.

Dyskeratosis congenita (DC) is a rare congenital X-linked disorder. The major clinical manifestations are abnormal skin pigmentation, nail dystrophy, and leukoplakia of mucosal membranes. About 50% of the patients develop bone marrow failure, which is partly responsible for the poor prognosis. Recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) has been administered to some neutropenic patients with DC, but only a moderate stimulation of neutropoiesis has been observed. We report on a patient with DC treated with recombinant human granulocyte-colony-stimulating factor (rhG-CSF). This treatment resulted in a substantial dose-dependent increase in the neutrophil count.

Adult↗

PubMed1994

Effect of hydroxyethyl starch on the activity of blood coagulation and fibrinolysis in healthy volunteers: comparison with albumin.

OBJECTIVE: The aim of this study was to investigate whether hydroxyethyl starch of medium molecular weight (200 daltons), compared with albumin, has specific effects on blood coagulation and fibrinolysis. DESIGN: A prospective, randomized, double-blind, crossover trial. SETTING: Laboratory at a university hospital. PATIENTS: Ten healthy male volunteers, 23 to 39 yrs old, with no history of hypersensitivity, who had normal physical examinations, and were free of a bleeding disorder. All patients did not ingest any medications for > or = 2 wks before or during the study period. INTERVENTION: Each volunteer received either 500 mL of hydroxyethyl starch (6% wt/vol, average molecular weight 200 kilodaltons, molar substitution 0.5 [ratio hydroxyethyl groups/glucose units] in 0.9% sodium chloride; average molecular weight of 200 kilodaltons) or a control of 500 mL of human albumin (5% albumin solution). After a washout period of 4 wks, subjects crossed over to the alternate treatment. MEASUREMENTS AND MAIN RESULTS: Blood samples were taken immediately before infusion and 20, 45, 75, 105, 165, 285, 405, and 1485 mins after the infusion started. Hematocrit, the blood coagulation parameters fibrinogen, activated partial thromboplastin time, factor VIII:C, thrombin-antithrombin III complexes, and the fibrinolytic parameters fibrin-split product D-Dimer, tissue type plasminogen activator, urokinase plasminogen activator, plasminogen activator inhibitor, and plasmin-antiplasmin complexes were measured. Except for factor VIII:C levels, which were significantly lower in the hydroxyethyl starch group, no other significant differences in the plasma levels of the parameters mentioned were detected between hydroxyethyl starch and albumin infusions. In one volunteer, who had a low initial factor VIII:C level of 51%, a decrease to 28% at 165 mins during hydroxyethyl starch infusion was found (corresponding albumin value at 165 mins was 41%). CONCLUSIONS: a) Medium molecular weight hydroxyethyl starch has a specific lowering effect on factor VIII:C concentrations; this phenomenon may be hazardous to patients who need full hemostatic competence and who receive medium molecular weight hydroxyethyl starch (e.g., as a plasma expander). b) Medium molecular weight hydroxyethyl starch does not specifically influence the activity of the fibrinolytic system.

Adult↗

PubMed1994

Successful re-treatment of an anti-interferon resistant polycythaemia vera patient with lymphoblastoid interferon-alpha N1 and in vitro studies on the specificity of the antibodies.

A polycythaemia vera patient who initially responded to recombinant IFN-alpha 2 (rIFN-alpha 2) treatment developed neutralizing antibodies (NA) against it and lost response. Despite raising the dose, clinical resistance persisted and NA increased when two alternative rIFN-alpha 2 preparations were used. When treatment was switched to lymphoblastoid IFN-alpha (lyIFN-alpha N1), clinical response was restored and maintained. During re-treatment, NA specific for the earlier rIFN-alpha 2 preparations redeveloped and cross-reacted extensively with each other but not with 'whole' lyIFN-alpha N1 and only minimally with the lyIFN-alpha 2 subtype within it. These findings demonstrate the relevance of NA specificities in the re-treatment of antibody-compromised patients.

Antibodies↗

PubMed1994

PML-RAR alpha PCR positivity in the bone marrow of patients with APL precedes haematological relapse by 2-3 months.

We report the results of serial tests in three patients with hyperleucocytotic AML M3 by haematological methods, coagulation assays and PCR analyses following treatment with ATRA and chemotherapy. All three patients became PCR negative in bone marrow and peripheral blood (sensitivity level 1 in 10(5) cells) after one cycle of ATRA + chemotherapy. However, they relapsed haematologically 6-9 months after achieving complete haematological remission. The haematological relapse was preceded by PCR positivity in the bone marrow by 3 months. Platelet counts decreased already during CHR, but dropped below normal levels only at the time of relapse. Coagulation parameters were not helpful for early prediction of relapse. Our results demonstrate that PCR analysis in the bone marrow is the best way to monitor patients with APL. However, in hyperleucocytotic patients, PCR negativity does not seem to indicate long-term remission.

Base Sequence↗

PubMed1994

The surface membrane antigen phenotype of human blood basophils.

Basophils are effector cells of allergic reactions and express a unique profile of cellular antigens (Ag). Using a combined toluidine-blue/immunofluorescence staining method, we were able to study the cell membrane Ag phenotype of normal human blood basophils with monoclonal antibodies (mAbs) against established and novel CD antigens. According to previous findings, basophils express CD9 (p24), CD11a (LFA-1 alpha-chain), CD11b (C3biR), CD11c (CR4), CD13 (aminopeptidase N), CDw17 (lactosylceramide), CD18 (beta-chain of beta 2), CD25 (IL-2R alpha-chain), CD26 (dipeptidylpeptidase), CD31 (PECAM), CD35 (CR1), CD38 (T10), CD43 (leukosialin), CD44 (Pgp-1), CD45 (pan-leukocyte Ag), and CD63 (basophil activation Ag). Various novel CD Ags were detected on basophils, including membrane cofactor protein (MCP) (CD46), the N-linked glycan CD47, decay-accelerating factor (DAF) (CD55), membrane attack complex inhibitory factor (MACIF) (CD59), LFA-3 (CD58), ICAM-2 (CD 102), ICAM-3 (CD50), C5a receptor (CD88), MIC-2/E2 (CD99), and the interleukin-1 (IL-1) R type II (CD121b). These data provide further evidence that basophils express a unique profile of surface membrane receptors for cytokines and immunomodulating compounds, as well as adhesion molecules and surface glycolipids.

Antigens, Surface↗

PubMed1994

Coincidence of severe aplastic anaemia with multiple sclerosis or thyroid disorders. Report of 5 cases.

Five patients with severe aplastic anaemia (SAA) who, simultaneously (n = 3) or consecutively (n = 2), presented with multiple sclerosis (MS) (n = 2) or immune hyperthyroidism (IHT) (n = 2) or subacute thyroiditis (n = 1) are described. Two female patients with MS developed SAA after a small dose of azathioprine. Another patient simultaneously presented with IHT and SAA. SAA and MS responded to cyclosporine while IHT required 131I. Relapsing SAA in 1 patient with MS was treated with antithymocyte globulin (ATG) which induced acute exacerbation of MS. Despite the low total dose of ATG (31.5 mg/kg), complete remission of SAA was obtained. Two other patients developed thyroid disorders, 42 and 106 months after successful immunosuppression with ATG/high-dose methylprednisolone. IHT and subacute thyroiditis were successfully treated with 131I or prednisolone, respectively, without recurrence of SAA in both cases. These are the first documented cases of SAA evolving in the course of MS while the coincidence with IHT was already described. Since enhanced expression of interferon-gamma plays a crucial role in SAA as well as in MS and in IHT, similar pathogenetic principles may apply for these seemingly unrelated disorders.

Adult↗

PubMed1994

Inhibition of stem cell factor dependent formation of human mast cells by interleukin-3 and interleukin-4.

In murines, interleukins (IL) 3, 4, 9, and 10, nerve growth factor, and stem cell factor induce or promote growth and differentiation of mast cells (MC). Increased stimulation and synergy was observed when combinations of cytokines were used. In man, no growth factor for human MCs had been identified until recently, when SCF was found to induce in vitro growth and differentiation of human MCs. In the present study, the effects of recombinant human IL-3 and IL-4 on SCF-dependent differentiation of human MCs from their circulating progenitor cells in long-term culture were analyzed. Surprisingly, both IL-3 and IL-4 were found to inhibit SCF-dependent formation of human MCs (SCF, 100 ng/ml: 36.4 +/- 18.7 x 10(3)/ml; SCF + IL-3, 100 U/ml: 23.4 +/- 4.2 x 10(3)/ml; SCF + IL-4, 100 U/ml: 7.4 +/- 4.4 x 10(3)/ml) and synthesis of MC tryptase (SCF, 100 ng/ml: 73.2 +/- 17.6 ng/ml; SCF + IL-3, 100 U/ml: 10.8 +/- 3.1 ng/ml [p < 0.01]; SCF + IL-4, 100 U/ml: 8.1 +/- 1.5 ng/ml, [p = 0.02]). The inhibitory effects of these cytokines on SCF-dependent formation of human MCs were associated with an increase in the number of macrophages (IL-3) or lymphocytes (IL-4) in the same cultures and may be due to competitive recruitment of cells from a pool of multilineage hematopoietic progenitor cells.

Cell Differentiation↗

PubMed1994

Soluble CD23 reliably reflects disease activity in B-cell chronic lymphocytic leukemia.

PURPOSE: This study was initiated to evaluate whether soluble CD23 (sCD23) reflects disease activity and tumor load in B-cell chronic lymphocytic leukemia (B-CLL) and to determine its prognostic potential for this disease. PATIENTS AND METHODS: The concentration of sCD23 was measured in the serum of 45 B-CLL patients, 50 patients with other lymphoproliferative disorders, and 41 healthy donors (HD). sCD23 serum levels from B-CLL patients were correlated with parameters of disease activity and total tumor mass (TTM) score. In selected cases, sCD23 was measured repeatedly over a 24-month period. Expression, density, and calculated total amount of membrane CD23 on peripheral-blood B-CLL cells, as well as its correlation to sCD23 levels in serum and supernatants, were determined. RESULTS: sCD23 in B-CLL patients serum was highly elevated as compared with other lymphoproliferative disorders, with the exception of immunocytoma (IC). Both advanced Rai stages and active forms of B-CLL were associated with higher levels of sCD23. There was a highly significant reciprocal relationship between sCD23 and lymphocyte count doubling time (LCDT). Serum sCD23 correlated positively with serum deoxythymidine kinase activity and TTM score, but not with absolute lymphocyte counts. The repetitive measurement of serum sCD23 showed the usefulness of this marker in monitoring disease progression in B-CLL. The total amount of membrane CD23 on in vitro-cultured B-CLL cells correlated significantly with sCD23 levels in the supernatant, whereas correlation between serum sCD23 and membrane CD23 on freshly isolated B-CLL cells was absent. CONCLUSION: Our results indicate that sCD23 is a highly sensitive and specific parameter with prognostic potential for B-CLL, which may be used as a tumor marker and may help to assess disease activity.

Biomarkers, Tumor↗

PubMed1994

P-glycoprotein expression as unfavorable prognostic factor in acute myeloid leukemia.

In order to further define the role of the MDR1 gene in acute myeloid leukemia (AML), we determined the association between the presence of P-glycoprotein on leukemic cells and the efficacy of therapy in patients with AML. Immunocytochemistry with monoclonal antibody C219 was performed to demonstrate the presence of P-glycoprotein. Positive staining ranged from 0 to 60% of the leukemic cells. For further analysis, patients were assigned into groups with 0-5% staining cells (group 1, n = 33) and with > 5% staining cells (group 2, n = 19). The complete remission rate of induction chemotherapy was 76% for group 1 but only 32% for group 2 (p = 0.002). The median duration of overall survival was 19 months for patients in group 1 as compared to 3 months for patients in group 2 (p = 0.007). The data indicate that P-glycoprotein expression is associated with an unfavorable prognosis in patients with AML.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

PubMed1994

Effects of a low molecular weight heparin (Fragmin) and of unfractionated heparin on coagulation activation at the site of plug formation in vivo.

The clinical benefits of unfractionated heparin (UFH) and low molecular weight heparin (LMWH) have been shown in many trials. However, the mode of action of heparin has not been fully elucidated. Thus, we wanted to study the effects of UFH and LMWH in vivo by measuring coagulation activation markers in blood obtained directly from a vascular injury site. In a double-blind, randomized, 3-way, cross-over study 18 healthy volunteers were given UFH (150 U/kg s.c.) and 2 doses of LMWH [35 U/kg s.c. (low dose, ld), 75 U/kg s.c. (high dose, hd)]. Prothrombin fragment 1+2 (F1+2), thrombin-antithrombin complex (TAT) and fibrinopeptide A (FPA) were measured in bleeding time blood and in venous blood before and after drug application. In addition, the effects of UFH and LMWH on in vitro coagulation tests were studied. Compared to base line, UFH and both ldLMWH and hdLMWH caused significant reductions of F1+2, TAT and FPA in bleeding time blood at 2 h. A marked effect of UFH and of hdLMWH was also seen at 5 h. The inhibition of FPA generation was more pronounced after hdLMWH compared to ldLMWH. In venous blood, UFH and LMWH caused reductions of F1+2, but not of TAT and FPA. In vitro, UFH predominantly affected the anti-IIa assays (activated partial thromboplastin time, thrombin time) and LMWH mainly the anti-Xa test system. Using a technique that investigates the activated coagulation system in vivo, a time- and dose dependent inhibitory effect of heparin on coagulation activation was detectable.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗

PubMed1994

Early detection of hematopoietic engraftment after bone marrow and peripheral blood stem cell transplantation by highly fluorescent reticulocyte counts.

At present, the appearance of neutrophils in the peripheral blood is considered to be the earliest sign of hematopoietic regeneration after myeloablative chemoradiotherapy. We studied erythroid regeneration in 27 allogeneic and 21 autologous marrow recipients using an automated reticulocyte counter employing a flow cytometric technique. Thereby, reticulocytes can be divided into a high, moderate and low fluorescent fraction according to RNA content. Marrow ablation caused an immediate and rapid fall in highly fluorescent reticulocytes (HFR) to zero in all patients. HFR reappeared after a median time of 7 days after allogeneic and 11 days after autologous marrow grafting. This was 7 and 2 days earlier than the appearance of first neutrophils. In allogeneic marrow recipients given erythropoetin after marrow infusion the median time to reach HFR of 0.2 and 0.5 x 10(9)/l was significantly shorter than time to reach similar absolute neutrophil counts (ANC). In allogeneic marrow recipients treated with G-CSF time to rise of HFR and ANC was almost exactly the same. Thus, automated flow cytometric reticulocyte counting allows early detection of hematopoietic regeneration and may be of clinical value for the early diagnosis of inadequate marrow function after marrow transplantation and the monitoring of erythroid regeneration under cytokine administration.

Adolescent↗

PubMed1994

Prolactin: a possible mediator of graft-versus-host disease following allogeneic bone marrow transplantation in humans.

We have evaluated post-transplant serum levels of prolactin with respect to source of donated bone marrow (BM) and to the occurrence of either acute and/or chronic graft-versus-host disease (GVHD). Forty adult patients underwent allogeneic (n = 35), autologous (n = 4) or syngeneic (n = 1) bone marrow transplantation for haematologic malignancy (n = 32) or aplastic anaemia (n = 8), respectively. Serum prolactin levels measured within 100 days post-transplant were related to patients' sex but otherwise proved unrelated to the occurrence or severity of GVHD and to the source of the BM graft (allogeneic, autologous, syngeneic). Beyond day 100 post-graft, however, serum prolactin levels proved significantly elevated in allogeneic recipients exhibiting chronic GVHD (p = 0.0004) and were unrelated to the patients' sex. In this group of patients, serum prolactin levels were not related to serum cyclosporin levels. In allogeneic recipients exhibiting no GVHD, serum prolactin levels were positively correlated with serum cyclosporin levels (p < 0.05). These data show that serum prolactin levels are significantly elevated beyond day 100 post-graft in recipients exhibiting chronic GVHD. Prolactin, a hormone recently shown also to be released by mononuclear leucocytes and to be involved in lymphocyte activation plays a hitherto unrecognized role in the pathogenesis of GVHD in humans.

Adolescent↗

PubMed1994

The risk of thromboembolism in asymptomatic patients with protein C and protein S deficiency: a prospective cohort study.

BACKGROUND: Prospective studies on the incidence of thrombosis in asymptomatic individuals with hereditary protein C- or protein S deficiency have not been performed so far. OBJECTIVE: We have carried out a prospective cohort study in 44 asymptomatic protein C- and protein S deficient subjects and in 49 asymptomatic non-deficient relatives (age at study entry > 14 years) of symptomatic deficient patients. METHODS: 20 asymptomatic protein C deficient (median age 20 years) and 24 asymptomatic protein S deficient patients (median age 21.5 years) were prospectively followed and compared with 20 asymptomatic non-deficient relatives (median age 25 years) of protein C- and 29 (median age 27 years) of protein S deficient patients. The total observation period was 118.8 patient years for protein C deficient and 92.8 for protein S deficient patients. Patients were not on anticoagulants except for short duration in case of high risk situations. RESULTS: Eight thromboembolic events (1 pulmonary embolism, 1 deep vein thrombosis + pulmonary embolism, 3 deep vein thrombosis, 1 caval vein thrombosis and 2 superficial vein thrombosis) occurred in 6 deficient patients. The incidence of thromboembolism was 2.5% per patient year for protein C deficient and 3.5% per patient year for protein S deficient patients. 4 events occurred spontaneously, in 2 patients thromboembolic events were triggered by high risk situations (caesarean section, minor trauma). In the controls no thromboembolic events occurred. The probability for thromboembolism was significantly higher in protein C and protein S deficient patients compared to the control group (Wilcoxon test, p = 0.002, log rank test, p = 0.001). One major and 5 minor uneventful surgeries were carried out in the deficient patients using heparin prophylaxis. 1/8 pregnancies was complicated by superficial vein thrombosis during the second trimester despite prophylactic heparin administration. The same pregnancy was complicated by pulmonary embolism 5 weeks after delivery after discontinuation of heparin. CONCLUSIONS: Asymptomatic deficient relatives of symptomatic patients with protein C or protein S deficiency are at an increased risk of thrombosis compared to nondeficient individuals. Prophylactic treatment seems to be highly effective in high risk situations.

Adolescent↗

PubMed1994

[Chronic lymphatic leukemia].

Chronic lymphocytic leukemia of the B-cell type (B-CLL) is the most common type of leukemia. The diagnosis is based on the demonstration of sustained lymphocytosis, bone marrow lymphocytosis and the presence of CD 19/CD5 positive cells. The most important prognostic factor is the stage of the disease (according to RAI or BINET) and the lymphocyte doubling time. Most early stage patients do not benefit from chemotherapy and, indeed, some of these patients never require treatment. Stage A patients with active disease and stage B patients are treated conventionally with chlorambucil/prednisone, but the optimum dosage and duration of chlorambcil treatment has not yet been established. In stage C patients anthracycline containing regimens appear to be more effective. The nucleoside analogues fludarabine and 2-chlorodeoxyadenosine (cladribine) have been shown to be active in patients refractory to alkylating agents. Their role in primary treatment is currently being evaluated in ongoing studies. For a small proportion of patients with advanced disease aged less than 55 years allogeneic or autologous bone marrow transplantation offers the chance of long term remission and possibly even cure, which never can be achieved with conventional chemotherapy.

Antineoplastic Combined Chemotherapy Protocols↗

PubMed1993

cDNA cloning of a major allergen from timothy grass (Phleum pratense) pollen; characterization of the recombinant Phl pV allergen.

We isolated a cDNA encoding a major grass pollen allergen from a timothy grass (Phleum pratense) pollen expression cDNA library using allergic patients' IgE. The complete cDNA encoded an allergen that binds IgE from about 80% of grass pollen-allergic patients. Significant sequence homology was found to other major grass pollen allergens from Kentucky bluegrass (Poa pratense) as well as from rye grass (Lolium perenne) which originally were believed to form different identities. Using different monoclonal and polyclonal antibodies raised against group V allergens we identified the recombinant protein as a group V allergen from timothy grass, Phl p V. In IgE-binding studies it is demonstrated that the rPhl p V allergen can be used to block binding of patients' IgE to natural group V isoallergens on two-dimensional immunoblots. IgE inhibition experiments show that up to 60% of grass pollenspecific IgE can be preadsorbed with the rPhl p V allergen from patients sera. The purified rPhl p V induced specific histamine release of blood basophils from grass pollen-allergic patients. This emphasizes the usefulness of the rPhl p V for diagnostic and therapeutic purposes and corroborates the view that specific diagnosis and therapy of type l allergy could be performed with a limited panel of relevant recombinant allergens.

Amino Acid Sequence↗

PubMed1993

Monocytes do not make mast cells when cultured in the presence of SCF. Characterization of the circulating mast cell progenitor as a c-kit+, CD34+, Ly-, CD14-, CD17-, colony-forming cell.

Mast cells (MC3) belong to the hemopoietic system and arise from hemopoietic precursor cells. Human MC progenitors can be detected in the bone marrow as well as in the peripheral blood (pb) and are responsive to the mast cell growth factor SCF, the ligand of the c-kit tyrosine kinase receptor. However, little is known about the subsets of cells that become committed to and differentiate into mature human MC. In this study, the identity of the circulating MC progenitor, previously felt to be a monocyte (Mo) or basophil (Ba), was investigated. For this purpose, CD14+ pb monocytes, CD17+ pb basophils and CD34+ cord blood cells were purified to homogeneity (> 95%) from mononuclear cells (normal adult donors, n = 17, cord blood, n = 2) by counter-flow centrifugation followed by cell sorting with mAb. In the presence of rhSCF, MC developed in long term suspension culture from pure CD34+ cells but not from pure Mo, pure Ba, or Ly (MC-tryptase levels on day 42: CD14+ Mo: 3.7 +/- 0.8 vs CD17+ Ba: 3.2 +/- 0.5 vs Ly: 2.0 +/- 1.5 vs control: 196.5 +/- 92.5 ng/ml, p < 0.001). Depletion of CD34+ cells from MNC resulted in a loss of MC in long term suspension culture, whereas depletion of either Mo, Ba, or Ly did not. In methyl-cellulose cultures in the presence of rhSCF, MC and tryptase could be detected in pure (CFU-mast) and mixed (CFU-myeloid/mast) MC colonies. Together, MC do not originate from circulating Mo, Ba, or Ly. The circulating MC progenitor is a CD34+, c-kit+, Ly-, CD14-, CD17- colony-forming cell. This is the first definitive demonstration that mast cells are replenished directly from early hemopoietic progenitors and thus form a unique cell lineage within the hemopoietic system.

Antigens, CD↗

PubMed1993

Pentostatin in prolymphocytic leukemia: phase II trial of the European Organization for Research and Treatment of Cancer Leukemia Cooperative Study Group.

BACKGROUND: B-cell prolymphocytic leukemias or T-cell prolymphocytic leukemias are aggressive variants of chronic lymphoid leukemias. The small studies conducted to date have shown median survival durations of approximately 3 years for patients who have B-cell prolymphocytic leukemia and 7.5 months for those who have T-cell prolymphocytic leukemia, compared with about 8 years for patients who have chronic lymphocytic leukemia. In chronic lymphocytic leukemia, chemotherapy consisting of alkylating agents such as cyclophosphamide and chlorambucil combined with prednisone has achieved overall response rates of 50% to 70%, but this regimen has resulted in response rates of less than 25% in prolymphocytic leukemia. Pentostatin (2'-deoxycoformycin; DCF) is a purine analogue that has shown activity in treatment of chronic lymphoid malignancies. PURPOSE: This prospective phase II trial by the Leukemia Cooperative Group of the European Organization for Research and Treatment of Cancer was performed to assess the activity and toxicity of DCF in prolymphocytic leukemia. METHODS: Twenty patients with B-cell or T-cell prolymphocytic leukemia were given DCF at a dosage of 4 mg/m2 intravenously once a week for 3 weeks, then every other week for three doses. Patients who had at least partial response received maintenance therapy once a month for a maximum of 6 months. Fourteen patients had B-cell prolymphocytic leukemia, and six had T-cell prolymphocytic leukemia, as evidenced by morphologic and immunologic criteria; three were previously untreated, eight had been given one or two chemotherapeutic regimens, and nine had been given more than two. RESULTS: One patient died of an unknown cause during the first 6 weeks of treatment, and one died of disseminated toxoplasmosis during the period of maintenance therapy, 5 months after achieving partial remission. Nine (45% response rate) of the 20 patients achieved partial remission, including seven (50%) of 14 with B-cell prolymphocytic leukemia and two (33%) of six with T-cell prolymphocytic leukemia. The median duration of response was 9 months (range, 2-30 months); for patients with B-cell prolymphocytic leukemia, the median remission duration was 12 months. No complete remission was observed. Toxic effects included nausea and vomiting (30%), infections (30%), and transient increase in liver enzymes (35%) and in creatinine (20%) levels. Eight patients experienced thrombocytopenia, the major hematologic toxic effect; four had grade 3 or 4 toxic effects. CONCLUSION: DCF is active in prolymphocytic leukemia, even as salvage therapy in patients who had received multiple prior chemotherapeutic regimens. IMPLICATIONS: Trials using DCF or other purine analogues alone or in combination with standard chemotherapeutic agents in front-line or salvage therapy are warranted to improve the prognosis of patients with prolymphocytic leukemia.

Adult↗

PubMed1993

Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein.

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.

B-Lymphocytes↗