PubMed Health⌕ Search

Biomedical subjects

K Ramm

Publications and source records attributed to K Ramm.

23 records · Page 2Linked to original sources
PubMed1982

Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid.

The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence. Maximal base-pairing of the established CEV and CSV sequences results in an extended rod-like secondary structure similar to that previously established for PSTV and as predicted from detailed physicochemical studies of all these viroids. Although the three viroid species sequenced to date differ in size and nucleotide sequence, there is 60--73% homology between them. As PSTV, CEV and CSV also contain conserved complementary sequences which are separated from each other in the native secondary structure. We postulate that the resulting 'secondary' hairpins, being formed and observed in vitro during the complex process of thermal denaturation of viroid RNA, must have a vital, although yet unknown, function in vivo. The possible origin and function of viroids are discussed on the basis of the characteristic structural features and of a considerable homology with U1a RNA found for a region highly conserved in the three viroids.

Base Sequence↗
PubMed1981

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Base Sequence↗
PubMed1980

[Clinical studies on chronic subdural haematomas in 140 adults (author's transl)].

Out of the 140 adult patients with chronic subdural haematoma 17% were female. An overall relationship of CSH cases to the total number of subdural haematomas was 27%. In only 78% of the CSH could a history of trauma be traced. Most of the patients were between the ages of 50 and 70. The main symptoms were headache, abnormal psychic behaviour and paresis. Alcoholism and anticoagulant therapy accounted for only 13% and 3% respectively. Recurrent bleeding occurred in 25% of cases not only after craniotomy but also after burr-holes. The total mortality was 15%. With regard to diagnosis and the indications for operation, angiography which was previously used has, since 1977, been superseded by the CT-scan.

Adolescent↗