PubMed Health⌕ Search

Biomedical subjects

K Seto

Publications and source records attributed to K Seto.

At least 109 records · Page 6Linked to original sources
PubMed1990

Influence of dorsal hippocampal stimulation and dorsal fornix lesions on hepatic glucose metabolism in rabbits.

We examined the effects of stimulation of the dorsal hippocampus and lesions of the dorsal fornix on glucose metabolism in liver slices of rabbits. Hippocampal stimulation decreased the 14C transfer rates from 14C-glucose into CO2, ketone bodies, cholesterol ester and free fatty acids, but increased the rates into triglyceride, phospholipids and glycogen. Fornix lesions had various effects on glucose metabolism, and the effects of hippocampal stimulation on glucose metabolism were abolished by fornix lesions. These observations support the hypothesis that the hippocampus is an integral part of the brain regulator system in the hepatic glucose metabolism.

Animals↗
PubMed1990

Influence of microinjection of insulin into the ventromedial hypothalamus on acetate metabolism in rumen epithelium of sheep.

Injections of 50 microU insulin into the ventromedial hypothalamic nuclei (VMH) in intact sheep decreased the rates of 14C transfer from 14C-1-acetate into CO2, glucose, ketone bodies, and increased the rates into triglyceride and phospholipids in rumen epithelium of sheep. Insulin injections into the parietal cortex of intact sheep or into the VMH of sheep with VMH lesions had no effect on the acetate metabolism in rumen epithelium as compared with the control groups which received saline injections into the same brain regions. These results support the view that the VMH serves as an integral part of an insulin-sensitive brain regulatory system in the acetate metabolism of rumen epithelium.

Acetates↗
PubMed1990

Ammonia production as a virulence expression by Mycoplasma salivarium.

Rabbits were inoculated intracutaneously with M. salivarium (ATCC 23064) cells. The size of the resulting swelling was significantly larger in 1) the sites inoculated with viable cells (7.5 x 10(9) CFU) suspended in a medium with arginine (arginine medium) than in those inoculated with killed cells, and in 2) those inoculated with cells suspended in arginine medium than with cells suspended in arginine-free medium. The swelling was enhanced when rabbits had previously been immunized with the organism. This effect was concluded to be due to ammonia which the organism produced by the hydrolysis of arginine through the arginine-dihydrolase pathway.

Ammonia↗
PubMed1990

[Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene].

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

Enterotoxins↗
PubMed1990

[Development and testing of cholera enterotoxin gene probe for detection of toxigenic Vibrio cholerae O1].

A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms. The structural genes of CT (ctx) were cloned from chromosomal DNA of CT producing V. cholerae O1 569B. We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe. The 32P-labeled CT-probe detected ctx in 72 isolates such as V. cholerae O1, V. cholerae non-O1 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization. The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V. cholerae.

DNA Probes↗
PubMed1990

Sleep apneas and cardiac arrhythmias in freely moving rats.

We studied the mechanisms of occurrences of apneas and bradyarrhythmias during sleep in five Wistar-Kyoto rats. We recorded electroencephalograms, electrocardiograms, chest wall movement, and diaphragmatic electromyograms (EMGdi) for three continuous days in each freely moving rat and demonstrated that: 1) 99% of the apneas and 99% of the bradyarrhythmias occurred during paradoxical sleep (PS), 2) 98% of the apneas were due to spontaneous cessations of respiratory drive, 3) the percentages among apneas accompanied with bradyarrhythmias were only about 30% and independent of the apneic durations, 4) every autoregressive power spectrum contained two significant components in the ranges of 50-80 and 110-140 Hz, which would be analogous to high-frequency oscillations postulated to originate in the synaptic input to the phrenic motoneurons from respiratory centers, and 5) spectral patterns of EMGdi signals varied with sleep states. These results suggest that "PS-related" neural activity modulating central respiratory output is important in inducing apneas and promoting bradyarrhythmias.

Animals↗
PubMed1990

Influence of incomplete bile duct obstruction on the occurrence of cholangiocarcinoma induced by diisopropanolnitrosamine in hamsters.

This study was performed to clarify the influence of incomplete bile duct obstruction (IBDO) on the occurrence of cholangiocarcinoma, using Syrian golden hamsters. These hamsters underwent simple laparotomy (SL) or IBDO at the choledochus and received diisopropanolnitrosamine (DIPN) once weekly for 20 weeks (SL-DIPN or IBDO-DIPN groups). Histological examination in the liver showed increased bile ductules, goblet cell metaplasia of the bile duct epithelium and cholangiocarcinoma in the two groups. The occurrence rates of cholangiocarcinoma at 20 weeks were 35% in the SL-DIPN group and 89% in the IBDO-DIPN group (p less than 0.01). The mean numbers of tumors per hamster in the IBDO-DIPN group were significantly higher than those in the SL-DIPN group (p less than 0.01). Regarding the composition of bile acid in the intraductal bile, both groups revealed an increase in primary bile acid, consisting of more than 80% of cholic acid. Bacteria were detected in the group with IBDO throughout the whole course. These results suggest that IBDO has an influence as promoter on the occurrence of DIPN-induced cholangiocarcinoma.

Adenoma, Bile Duct↗
PubMed1990

[Detection of two Shiga-like toxins from Escherichia coli O157:H7 isolates by the polymerase chain reaction method].

Fourteen isolates of E. coli O157:H7 and five isolates of S. dysenteriae type-1 were examined by polymerase chain reaction (PCR) for the structural genes (slt-I or slt-II), encoding Shiga-like toxins (SLTs). The two primer pairs (V1; 5'AGTTAATGTGGTGGCGAA and V2; 5'GACTGCGTCAGTGAGGTT for SLT-I, V3; 5'TTCGGTATCCTATTCCCG and V4; 5'TCTCTGGTCATTGTATTA for SLT-II) used were of the same positions representing the DNA sequence covering 471bp of the slt-I or slt-II. A 5-microliter portion of boiled bacterial culture broth was used as template DNA in a PCR-reaction mixture of 50 microliters. Two classes, slt-I alone or both slt-I and slt-II, were recognized in E. coli strains. All of S. dysenteriae type-1 strains examined contained slt-I alone. Our results indicate that PCR using these primer pairs is a simple, rapid, sensitive, and specific method and suitable for use in routine diagnostic microbiology laboratories.

Bacterial Toxins↗
PubMed1990

[Does midazolam release histamine?].

Effects of induction with midazolam on serum histamine levels (Study 1) and the volume as well as pH of gastric juice (Study 2) were studied. Anesthesia was induced with midazolam 0.2 mg.kg-1 in midazolam group, thiamylal 4 mg.kg-1 in control group. In Study 1, serum histamine levels were measured with high performance liquid chromatography till 180 minutes after intubation. There were no statistical significance between the two groups in serum histamine levels at all points. But in midazolam group, at 30 minutes after intubation, the histamine level was significantly lower than the preinduction level. In control group, serum concentration of histamine increased but not significantly. In Study 2, gastric juice was sampled through naso-gastric tube inserted on the morning of operation. Gastric juice pH was measured with the use of pH Strip (E. Merck, F.R. Germany). There were no significant differences between the two groups in volume as well as pH of gastric juice at all points. It is concluded that midazolam used for induction of anesthesia might decrease histamine release, but it has no clinical effects on gastric juice secretion.

Adult↗
PubMed1990

[Does induction with midazolam decrease stress response during anesthesia?].

The effects of midazolam on stress response during surgery compared with thiamylal were studied. Twelve patients were divided into 2 groups at random; midazolam group and thiamylal group. Anesthesia was induced with midazolam 0.2 mg.kg-1 or thiamylal 4 mg.kg-1 in each group, and maintained with O2 2 l.min-1, N2O 4 l.min-1 and enflurane. The plasma concentration of catecholamine was measured at preinduction, 10, 30, 60, 120 and 180 minutes after intubation. No significant differences were seen between 2 groups in plasma concentration of catecholamine. In midazolam group, plasma concentration of epinephrine decreased significantly 10 minutes after intubation as compared with preinduction level. The plasma concentration of norepinephrine in midazolam group tended to decrease. In thiamylal group, plasma concentration of norepinephrine tended to increase and increased significantly at 120 and 180 minutes after intubation as compared with preinduction level. These results suggest that induction with midazolam suppresses stress response during anesthetic induction and surgery more intensely than induction with thiamylal.

Adult↗
PubMed1990

[Total intravenous anesthesia with continuous infusion of midazolam].

Continuous infusion of midazolam and fentanyl were used in total intravenous anesthesia. Anesthesia was induced with midazolam 0.3 mg.kg-1 in 100% O2. Tracheal intubation was facilitated with succinylcholine 1 mg.kg-1 after precurarization with pancuronium 1 mg. The infusion regimen of midazolam was as follows; an initial infusion of 0.68 mg.kg-1.hr-1 for 15 min followed by a maintenance infusion of 0.125 mg.kg-1.hr-1, and about 30 min before the end of operation infusion was stopped. Fentanyl and pancuronium were injected as required. During operation, blood pressure and heart rate were stable with a small dose of nicardipine. Total dose of fentanyl was the same as in NLA. Extubation was done as quickly as in NLA, after aminophylline infusion which was said to reverse midazolam. In the recovery room, patients were asleep and snored. But they opened eyes and responded to verbal command. Respiratory rate and PaCO2 were in normal ranges. Total intravenous anesthesia was possible with midazolam and fentanyl but a further study is necessary.

Adult↗
PubMed1990

[Total intravenous anesthesia with continuous infusion of midazolam--study on plasma levels of midazolam and catecholamines].

Total intravenous anesthesia was performed with continuous infusion of midazolam and bolus injection of fentanyl. A bolus injection of midazolam 0.3 mg.kg-1 was followed by an infusion regimen with an initial infusion rate of 0.68 mg.kg-1.hr-1 for 15 min followed by a maintenance infusion of 0.125 mg.kg-1.hr-1 and infusion was stopped at about 30 min before the end of operation. Fentanyl and pancuronium were injected as required. Nicardipine was given for intraoperative hypertension. Plasma concentrations of epinephrine and norepinephrine decreased significantly at 10 min after induction, but increased significantly during operation. Therefore, this anesthetic method was considered not to be so deep. Plasma concentrations of midazolam were higher than 200 ng.ml-1 during operation. After discontinuation of midazolam infusion, its concentration decreased quickly, and the elimination half life of midazolam was 1.675 +/- 0.2807 hr. The value was not so large as we had anticipated. Total intravenous anesthesia with continuous infusion of midazolam and bolus injection of fentanyl is thought to produce light anesthesia. Plasma concentration of midazolam decreased quickly.

Adult↗
PubMed1990

[Midazolam for rapid sequence induction].

We compared midazolam 0.2 mg.kg-1 and fentanyl 50 micrograms with thiamylal 4 mg.kg-1 for rapid sequence induction. We could use midazolam safely in patients with bronchial asthma or drug allergy. There was no difference in time from the beginning of induction to intubation between midazolam treated group and thiamylal treated group. Changes in systolic as well as diastolic blood pressure and heart rate during 2 hours from intubation were smaller in midazolam treated group than in thiamylal treated group. In midazolam treated group, no arrhythmias were observed at the time of intubation. We could reduce the amount of anesthetics in midazolam treated group during 2 hours from intubation. From the results mentioned above, we conclude that midazolam is a useful agent for rapid sequence induction.

Adult↗
PubMed1989

Correlation between reversing of multidrug resistance and inhibiting of [3H]azidopine photolabeling of P-glycoprotein by newly synthesized dihydropyridine analogues in a human cell line.

Ten synthetic dihydropyridine analogues were investigated for their ability to reverse drug resistance in a multidrug-resistant human carcinoma cell line, KB-Cl. Four dihydropyridine analogues completely reversed the resistance, three lowered the resistance, and three had little effect. The radioactive photoactive dihydropyridine calcium channel blocker, [3H]azidopine, photolabels P-glycoprotein in membrane vesicles from KB-Cl cells. This photolabeling was almost completely inhibited by excess dihydropyridine analogues that reversed or lowered drug resistance. In contrast, the labeling was not significantly inhibited by analogues that do not reverse resistance. Among other reversing agents, cepharanthine and reserpine inhibited the [3H]azidopine photolabeling, but thioridazine did not. N-Solanesyl-N,N'-bis(3,4-dimethoxybenzyl)ethylenediamine slightly inhibited the labeling at 100 microM. An anticancer agent, vinblastine, also inhibited the labeling. The correlation between the reversing of the drug resistance and the inhibition of the [3H]azidopine photolabeling of P-glycoprotein by dihydropyridine analogues suggests a role for P-glycoprotein in multidrug resistance and also the reversing of the resistance by dihydropyridine analogues.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1989

Excitatory influence of the accessory olfactory bulb on tuberoinfundibular arcuate neurons of female mice and its modulation by oestrogen.

The role of the accessory olfactory bulb in conveying pheromonal information to tuberoinfundibular arcuate neurons was examined electrophysiologically in chloral hydrate-anaesthetized, oestrogen (0.5 micrograms in silastic capsules)-treated and untreated ovariectomized Balb/c female mice. Electrical stimulation of the accessory olfactory bulb orthodromically excited part of tuberoinfundibular neurons which were antidromically stimulated from the median eminence and histologically verified as being located within the arcuate nucleus. No inhibitions followed accessory bulb stimulation. The excitatory response to accessory bulb stimulation was reversibly blocked by the local anaesthetic lignocaine infused into the amygdala. The percentage of tuberoinfundibular arcuate neurons responding to accessory bulb stimulation was significantly higher in oestrogen-treated than in untreated animals. There was no difference between the two groups for the antidromic activation threshold, spontaneous firing rate, absolute refractory period or frequency of successful antidromic propagation into the soma of tuberoinfundibular arcuate neurons. In oestrogen-treated preparations, tuberoinfundibular arcuate neurons responsive and unresponsive to accessory bulb stimulation could be distinguished by the frequency of successful antidromic propagation into the soma. These studies demonstrate that olfactory relay neurons in the accessory olfactory bulb act to enhance the activity of a subpopulation of tuberoinfundibular arcuate neurons via the amygdala and that this neural transmission is modulated by oestrogen.

Action Potentials↗
PubMed1989

Influence of microinjection of glucagon into the amygdala on hepatic acetate metabolism in rabbits.

Glucagon was injected directly into the medial amygdala (AMYG) of rabbits, and changes in hepatic acetate metabolism were studied. The injection of 3 ng glucagon into the AMYG of intact rabbits increased the rates of 14C transfer from 14C-1-acetate into CO2, glucose, ketone bodies, cholesterol ester, free fatty acids and phospholipids but decreased those of 14C transfer into triglyceride. However, the glucagon injection into the AMYG of rabbits with lesions of stria terminals or into the parietal cortex of intact rabbits had no effects on the hepatic acetate metabolism. These observations support the hypothesis that the AMYG is a part of the glucagon-sensitive brain regulator system in the hepatic acetate metabolism.

Acetates↗
PubMed1989

Influence of electrical stimulation of the limbic structure on adrenocortical steroidogenesis in hypophysectomized rats.

The effects of electrical stimulation of the medial amygdala (AMYG) and dorsal hippocampus (DHPC) on the rates of 14C transfer from 14C-1-acetate into adrenocortical steroids in adrenal slices of hypophysectomized rats were investigated. The 14C transfer rates into corticosterone were increased by stimulation of the AMYG and DHPC. The 14C transfer rates into cortisol were increased by the AMYG stimulation but were not altered by the DHPC stimulation. From these results, it might be suggested that these limbic structures were involved in the regulation of adrenocortical steroidogenesis without participation of the pituitary.

Adrenal Cortex Hormones↗