PubMed Health⌕ Search

Biomedical subjects

K Shimotohno

Publications and source records attributed to K Shimotohno.

At least 217 records · Page 12Linked to original sources

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

Acetyltransferases↗

Structure of HTLV and its biological function in leukemogenesis of adult T-cell leukemia.

There is a high homology of nucleotide sequence between 3' two-thirds of the X (or pX) regions of human T-cell leukemia virus (HTLV)-I, and of HTLV-II. Monoclonal antibody against p41 coded from X-IV, an open reading frame of X region of HTLV-I, was established. Two proteins coded by Xb, one of the open reading frames in X region of HTLV-II, were newly identified as p24 and p26. The expression of X protein of HTLV-II in the reconstituted mouse embryonal carcinoma cell line, which shows myoblastic morphology, reverted the morphology to that of the original embryonal carcinoma cells. This suggests that the function of X protein is to disturb the regulation of cell lineage determination. Leukemogenesis of adult T-cell leukemia (ATL) is also considered to consist of multisteps, in which HTLV-I constitutes one step, other factors also being involved. Even the role of HTLV-I factor could be similarly played by other factor(s). In agreement with this hypothesis, there are patients with ATL without associated HTLV-I.

Adult↗

Monoclonal antibody NCC-pX-1G reactive with gene products coded from X regions of human T-cell leukemia virus.

Monoclonal antibody NCC-pX-1G (IgG1, kappa) was obtained by the hybridoma technique by immunization of mice with the C-terminal 54 amino acids of the pX protein, made from the 3'-terminal portion of the pX gene conjugated with bovine growth hormone gene transfected in E. coli. NCC-pX-1G recognized 41 kilodalton pX protein of HTLV-I, and immunocytochemically stained HUT102 and other HTLV-I-infected cell lines, but no reaction was observed with non-HTLV-I-infected cell lines or normal human tissue cells.

Animals↗

Methylation pattern of human T-cell leukemia virus in vivo and in vitro: pX and LTR regions are hypomethylated in vivo.

The methylation patterns of the gag, pol, env, pX and LTR regions of proviral DNA of human T-cell leukemia/lymphoma virus type I (HTLV) in fresh leukemic cells and established cell lines were examined using HpaII/MspI endonuclease. Peripheral blood lymphocytes (PBL) isolated from patients with adult T-cell leukemia/lymphoma (ATL) did not express viral antigens of HTLV, but PBL that had been cultured for 2 days did express these viral antigens. Most parts of the gag, pol and env regions of the HTLV provirus in PBL isolated from 12 ATL patients and PBL cultured for 2 days were hypermethylated as reported by others. In contrast, in 10 established cell lines that harbored HTLV genomes and expressed viral antigens, HTLV proviruses were hypomethylated. In one cell line, ATL-IK, which harbored an HTLV genome but did not produce viral antigens, the gag, pol and env regions were hypermethylated. However, two HpaII sites, one in the middle of the gag region and the other in the middle of the pol region, were not methylated even in PBL from most ATL patients. Furthermore, the pX and LTR regions were hypomethylated not only in established cell lines but also in PBL of ATL patients. The hypomethylation of the pX and LTR regions detected in fresh leukemic cells of ATL patients may have some etiological significance in cell transformation by controlling the level of transcription of these regions, or modulating the binding of some factors to these regions.

Adult↗

Transmission of human T-cell leukemia virus type I to an S+L- cat kidney cell line.

The S+L- cat kidney cell line CCC was cocultivated with lethally irradiated human lymphoid cell lines that were producing human T-cell leukemia virus type I (HTLV-I). Eight of nine S+L- CCC sublines that had been cocultivated with nine different HTLV-producing T-cell lines gave positive reactions for HTLV antigens by indirect immunofluorescence assay. One subline CCC/2M was cloned. The percentages of fluorescent cells differed markedly in different sublines and clones. Southern blot hybridization with HTLV probes and electrophoresis of immunoprecipitates indicated that defective HTLVs were often transmitted into S+L- cat cells. S+L- CCC cells were permissive for HTLV and the properties of HTLV-infected cat cells were heterogeneous.

Animals↗

Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type II: an open reading frame for the protease gene.

The entire nucleotide sequence of an infectious clone of human T-cell leukemia virus type II provirus was determined. This provirus consists of 8952 nucleotides. In addition to long terminal repeats and gag, pol, env, and X, a protease gene that is responsible for processing the gag precursor protein was found. The protease gene is encoded in a different frame from gag and pol and was located between the gag and pol open reading frames. The 5' region of the protease gene overlaps the 3' gag region. Coding regions of the provirus show about 60% homology with those of human T-cell leukemia virus type I at the nucleotide level. The evolutionary relationship between human T-cell leukemia virus types I and II is discussed.

Antigens, Viral↗

Identification of new gene products coded from X regions of human T-cell leukemia viruses.

Antibodies were raised against oligopeptides deduced from the nucleotide sequence in the conserved region located between env and the 3' long terminal repeat in human T-cell leukemia virus type I (HTLV-I) and type II (HTLV-II) to detect a protein coded from this region in virus-infected cells. Two of these antibodies precipitated a protein of 41 kilo-daltons in HTLV-I-infected cell lines and a protein of 38 kilo-daltons in HTLV-II-infected cells. The protein in HTLV-I-infected cells was precipitated by plasma from patients with adult T-cell leukemia but not by plasma from a normal adult. These results indicate that these proteins were translated from new coding regions (X) present in HTLV-I and HTLV-II.

Base Sequence↗

Structure of the pX protein deduced from the nucleotide sequence of a cDNA clone of pX mRNA in cells infected with human T-cell leukemia virus type I.

A splice donor site of pX mRNA of human T-cell leukemia virus type I was elucidated by analyzing a cDNA clone of poly A+ RNA isolated from cat fibroblast cells infected with the virus. The donor site was located near the 5' end of the env gene. The putative N-terminal amino acid sequence of the pX protein was deduced to be Met-Ala-His---.

Amino Acid Sequence↗

Human T-cell leukemia virus x gene.

The human T-cell leukemia virus (HTLV) types I and II are associated with specific hematological cancers. These viruses rapidly transform normal T-lymphocytes in vitro. The mechanism of HTLV-induced leukemogenesis is unknown. Structural analysis of HTLV-I and HTLV-II has revealed sequences of unknown function, termed X, at the 3' end of the proviral genome. The distal two-thirds of the X sequences are highly conserved between HTLV-I and HTLV-II. We have shown that these conserved X sequences contain a gene, termed x, that is expressed in both HTLV-I and HTLV-II by identifying a subgenomic X RNA as well as the proteins encoded by these messages. The function of this unique x gene is unknown; however, its conservation and expression suggest that it may play a role in HTLV replication and in HTLV-induced leukemogenesis.

Cell Line↗

Myristylation of gag protein in human T-cell leukemia virus type-I and type-II.

We found that p19gag of HTLV-I and p23gag of HTLV-II are myristylated. The p28, which is immunologically cross-reactive with monoclonal antibody against p19gag of HTLV-I was also shown to be myristylated in the HTLV-I-infected cell lines MT-2 and HUT102. However, no myristylated p28 was found in HTLV-II-infected cell lines, Mo and Ton1.

Antibodies, Monoclonal↗

Immortalization of peripheral blood lymphocytes of cats by human T-cell leukemia virus.

Peripheral blood lymphocytes of domestic cats were co-cultivated with lethally irradiated MT-2 cells, which produced human T-cell leukemia virus type 1 (HTLV-I). Two cat lymphoid cell lines, CaL-1 and CaL-2, established and maintained without exogenously added T-cell growth factor, were characterized after more than 6 months of cultivation. These cells grew in suspension, had a chromosome number of 38 and lacked cytoplasmic and surface immunoglobulins. CaL-2 cells formed E-rosettes. Both cell lines harbored HTLV genomes but not human Alu family sequences, which are highly repetitious in the human genome, suggesting that transfer of human DNA fragments was not necessary for their immortalization or transformation. HTLV antigens were detected in CaL-1 and CaL-2 cells by indirect immunofluorescence assay. CaL-1 and CaL-2 cells both expressed viral proteins with apparent molecular weights of 53 kd, 24 kd and 19 kd, and CaL-2 cells also expressed 28 kd and 20 kd proteins. Reverse transcriptase activity was detected in culture fluid of CaL-2 cells, but not of CaL-1 cells. CaL-2 cells but not CaL-1 cells had syncytium-induced activity. These findings indicated that lymphocytes of cats, especially T lymphocytes, were susceptible to infection with HTLV and to immortalization by HTLV.

Animals↗

Expression of the 3' terminal region of human T-cell leukemia viruses.

Human T-cell leukemia viruses (HTLV) are closely associated with some human T-cell leukemias and lymphomas. A unique 3' region of the HTLV genome is believed to be involved in HTLV-induced cellular transformation, although the function of this region has yet to be determined. A subgenomic messenger RNA transcribed from this region of HTLV has now been characterized. These results provide direct evidence for the expression of a novel gene in HTLV.

Base Sequence↗

Identification of the putative transforming protein of the human T-cell leukemia viruses HTLV-I and HTLV-II.

The human T-cell leukemia viruses HTLV-I and HTLV-II are unique among the transforming retroviruses of vertebrates in their ability to transform human T cells in vitro and in their close association with human malignancies (T-cell lymphomas and leukemia). Their genomes are relatively simple, containing the genes gag, pol, env, and a 3' region termed "X." This 3' region may be responsible for the transforming potential of the viruses. The existence of proteins encoded by the 3' region has been postulated on the basis of multiple open reading frames. In the present study this region is shown to contain a gene encoding a protein of 40 kilodaltons in HTLV-I and 37 kilodaltons in HTLV-II. It is proposed that these proteins be called, respectively, p40xI and p37xII.

Amino Acid Sequence↗

Estimation of kinetic parameters for substrate and inhibitor in a reaction with an enzyme sample containing different types of inhibitor.

The method of kinetic analysis is developed to obtain the maximum velocity (Vm), the Michaelis constant (Km) and the parameters characterizing the inhibitors in an impure enzyme reaction, contaminated with one of four types of inhibitor (competitive, noncompetitive, uncompetitive and mixed-type). Although the reaction rate decreases with the increasing concentration of the enzyme sample containing an inhibitor, the double-reciprocal plot of the rate against the sample concentration becomes linear. The slopes of these linear plots at several different concentrations of substrate provide Km and the specific enzyme activity, which is proportional to Vm, in the sample. These linear straight lines intersect in a point, of which the coordinates give the unique parameters for the inhibitor. To prove the validity of this kinetic method, the model experiments were carried out with acetylcholinesterase and its inhibitors, phenyltrimethylammonium and trimethylammonium. The present method was applied to the measurement of the specific activity of galactosylceramide galactosidase in the mouse cerebral homogenate. In addition, a kinetic method is indicated for the inhibition of an enzymatic reaction by a contaminant which binds the substrate to reduce the fraction available to the enzyme.

Acetylcholinesterase↗

Chemical synthesis of the 5'-terminal part bearing cap structure of messenger RNA of cytoplasmic polyhedrosis virus (CPV): m7G5'pppAmpG and m7G5'pppAmpGpU.

The 5'-terminal structures of mRNA bearing the so-called 'cap' from cytoplasmic polyhedrosis virus (CPV), m7G5' pppAmpG and m7G5' pppAmpGpU, were first chemically synthesized. S,S-Di(4-methoxyphenyl) N6-benzoyl-2'-O-methyladenosine 5'-phosphorodithioate ((ArS) 2pAbmz) was prepared by phosphorylation of the 5'-hydroxyl group of N6-benzoyl-2'-O-methyladenosine with S,S-di(4-methoxyphenyl) phosphorodithioate by TPS. By the triester approach using (ArS) 2pAbmz as starting material, the protected dinucleotide and trinucleotide bearing 5'-phosphate group were synthesized. The protective groups of the dinucleotide and trinucleotide were removed to obtain pAmpG and pAmpGpU, respectively. By the reaction of a capping agent ((PhS) ppm7G) with pAmpG and pAmpGpU in the presence of silver nitrate or iodine. The 5'-terminal structure of the messenger RNA strand of CPV which was labelled isotopically, was confirmed completely as m7G5' pppAmGpU by cochromatography with the materials chemically synthesized here.

Chemical Phenomena↗

Nucleotide sequence of the 3' region of an infectious human T-cell leukemia virus type II genome.

The nucleic acid sequence of the 3' region of human T-cell leukemia virus type II (HTLV-II) proviral DNA was determined using a HTLV-II proviral clone that could be recovered as infectious, transforming virus. The sequence data indicate a region of unknown function of approximately equal to 1.6 kilobase pairs in the 3' region, analogous to the X region previously identified in human T-cell leukemia virus type I (HTLV-I). Three overlapping open reading frames are present in the X region of HTLV-II. One of these open reading frames, Xc, is most likely to encode a protein product, because it has greater predicted amino acid sequence homology (78%) with the X-IV region of HTLV-I and a greater percentage of its base differences with X-IV at the third nucleotide position of codons than do the other open reading frames. Sequences of the X-region that include the open reading frames are conserved in two deletion mutants of HTLV-II, which are associated with a subline of Mo cells with a decreased dependence on fetal bovine serum.

B-Lymphocytes↗