Biomedical subjects

K Shirotani

Publications and source records attributed to K Shirotani.

At least 19 recordsLinked to original sources

PubMed2001

Alzheimer's beta-secretase, beta-site amyloid precursor protein-cleaving enzyme, is responsible for cleavage secretion of a Golgi-resident sialyltransferase.

The deposition of amyloid beta-peptide (A beta) in the brain is closely associated with the development of Alzheimer's disease. A beta is generated from the amyloid precursor protein (APP) by sequential action of beta-secretase (BACE1) and gamma-secretase. Although BACE1 is distributed among various other tissues, its physiological substrates other than APP have yet to be identified. ST6Gal I is a sialyltransferase that produces a sialyl alpha 2,6galactose residue, and the enzyme is secreted out of the cell after proteolytic cleavage. We report here that BACE1 is involved in the proteolytic cleavage of ST6Gal I, on the basis of the following observations. ST6Gal I was colocalized with BACE1 in the Golgi apparatus by immunofluorescence microscopy, suggesting that BACE1 acts on ST6Gal I within the same intracellular compartment. When BACE1 was overexpressed with ST6Gal I in COS cells, the secretion of ST6Gal I markedly increased. When APP(SW) (Swedish familial Alzheimer's disease mutation), a preferable substrate for BACE1, was coexpressed with ST6Gal I in COS cells, the secretion of ST6Gal I significantly decreased, suggesting that that the beta-cleavage of overexpressed APP(SW) competes with ST6Gal I processing. In addition, BACE1-Fc (Fc, the hinge and constant region of IgG) chimera cleaved protein A-ST6Gal I fusion protein in vitro. Thus, we conclude that BACE1 is responsible for the cleavage and secretion of ST6Gal I.

Alzheimer Disease↗

PubMed2001

Suppression of Ca2+ influx through L-type voltage-dependent calcium channels by hydroxyl radical in mouse cerebral cortical neurons.

In the present study, we investigated the effect of hydroxyl radical (.OH) produced by the Fenton reaction with FeSO(4) to H(2)O(2) on Ca2+ influx by measuring [(45)Ca2+] influx into mouse cerebral cortical neurons in primary culture.OH formed from 3 microM FeSO(4) and 0.01 microM H(2)O(2) significantly reduced 30 mM KCl-induced [(45)Ca2+] influx and this reduction was abolished by .OH scavengers such as N,N'-dimethylthiourea and mannitol. Nifedipine (1 microM), an inhibitor for L-type voltage-dependent Ca2+ channels (VDCCs) showed no additive effect on the reduction of the 30 mM KCl-induced [(45)Ca2+] influx, while the inhibitors for P/Q- and N-type VDCCs showed further suppression of the KCl-induced [(45)Ca2+] influx even in the presence of .OH. Bay k 8644, an activator of L-type VDCCs, dose-dependently stimulated [(45)Ca2+] influx, and this stimulation disappeared in the presence of nifedipine. Similarly, .OH also suppressed significantly [(45)Ca2+] influx induced by Bay k 8644. These inhibitory actions of .OH on the KCl- and Bay k 8644-induced [(45)Ca2+] influx were completely abolished by .OH scavengers. These results indicate that .OH has the activity to suppress Ca2+ influx through L-type VDCCs.

3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethy↗

PubMed2001

Metabolic regulation of brain Abeta by neprilysin.

Amyloid beta peptide (Abeta), the pathogenic agent of Alzheimer's disease (AD), is a physiological metabolite in the brain. We examined the role of neprilysin, a candidate Abeta-degrading peptidase, in the metabolism using neprilysin gene-disrupted mice. Neprilysin deficiency resulted in defects both in the degradation of exogenously administered Abeta and in the metabolic suppression of the endogenous Abeta levels in a gene dose-dependent manner. The regional levels of Abeta in the neprilysin-deficient mouse brain were in the distinct order of hippocampus, cortex, thalamus/striatum, and cerebellum, where hippocampus has the highest level and cerebellum the lowest, correlating with the vulnerability to Abeta deposition in brains of humans with AD. Our observations suggest that even partial down-regulation of neprilysin activity, which could be caused by aging, can contribute to AD development by promoting Abeta accumulation.

Aging↗

PubMed2001

NMDA receptor activation enhances diazepam binding inhibitor and its mRNA expressions in mouse cerebral cortical neurons.

Effects of N-methyl-D-aspartate (NMDA) on diazepam binding inhibitor (DBI) and its mRNA expression in mouse cerebral cortical neurons were examined. A significant increase in DBI mRNA expression was observed 1 day after the exposure to 0.1 microM NMDA and the maximal expression occurred 2 days after the exposure, whereas transient exposure to 0.1 microM NMDA for 15 min, 1 and 3 h produced no changes in the expression. Similarly, no changes in the expression were found by the concomitant exposure to NMDA and MK-801, a NMDA receptor antagonist, for 72 h subsequent to the incubation with NMDA alone for 3 h. Such NMDA-induced increases in DBI mRNA expression were dose-dependently inhibited by MK-801. Moreover, neuronal DBI content significantly increased by treatment with NMDA, which was completely abolished by MK-801. These results indicate that continuous activation of NMDA receptors is an essential factor for increasing DBI expression in the neurons.

Animals↗

PubMed2001

Neprilysin degrades both amyloid beta peptides 1-40 and 1-42 most rapidly and efficiently among thiorphan- and phosphoramidon-sensitive endopeptidases.

To identify the amyloid beta peptide (Abeta) 1-42-degrading enzyme whose activity is inhibited by thiorphan and phosphoramidon in vivo, we searched for neprilysin (NEP) homologues and cloned neprilysin-like peptidase (NEPLP) alpha, NEPLP beta, and NEPLP gamma cDNAs. We expressed NEP, phosphate-regulating gene with homologies to endopeptidases on the X chromosome (PEX), NEPLPs, and damage-induced neuronal endopeptidase (DINE) in 293 cells as 95- to 125-kDa proteins and found that the enzymatic activities of PEX, NEPLP alpha, and NEPLP beta, as well as those of NEP and DINE, were sensitive to thiorphan and phosphoramidon. Among the peptidases tested, NEP degraded both synthetic and cell-secreted Abeta1-40 and Abeta1-42 most rapidly and efficiently. PEX degraded cold Abeta1-40 and NEPLP alpha degraded both cold Abeta1-40 and Abeta1-42, although the rates and the extents of the digestion were slower and less efficient than those exhibited by NEP. These data suggest that, among the endopeptidases whose activities are sensitive to thiorphan and phosphoramidon, NEP is the most potent Abeta-degrading enzyme in vivo. Therefore, manipulating the activity of NEP would be a useful approach in regulating Abeta levels in the brain.

Amino Acid Sequence↗

PubMed2001

Peroxynitrite affects Ca2+ influx through voltage-dependent calcium channels.

The effect of peroxynitrite (OONO-) on voltage-dependent Ca2+ channels (VDCCs) was examined by measuring [45Ca2+] influx into mouse cerebral cortical neurones. OONO- time- and dose-dependently increased [45Ca2+] influx and this increase was abolished by manganese (III) tetrakis (4-benzoic acid) porphyrin, a scavenger for OONO-. Inhibition of cyclic GMP (cGMP) formation did not alter the OONO(-)-induced [45Ca2+] influx. OONO-, as well as 30 mm KCl, significantly increased fluorescence intensity of cell-associated bis-(1,3-dibutylbarbituric acid) trimethine oxonol (bis-oxonol). Tetrodotoxin and membrane stabilizers such as lidocaine dose-dependently suppressed OONO(-)-induced [45Ca2+] influx. Although each of 1 microM nifedipine and 1 microM omega-agatoxin VIA (omega-ATX) significantly inhibited the OONO(-)-induced [45Ca2+] influx and the concomitant presence of these agents completely abolished the influx, 1 microM omega-conotoxin GVIA (omega-CTX) showed no effect on the influx. On the other hand, OONO- itself reduced 30 mM KCl-induced [45Ca2+] influx to the level of [45Ca2+] influx induced by OONO- alone, and the magnitude of this reduction was as same as that of KCl-induced [45Ca2+] influx by omega-CTX. These results indicate that OONO- increases [45Ca2+] influx into the neurones through opening P/Q- and L-type VDCCs subsequent to depolarization, and inhibits the influx through N-type VDCCs.

Anesthetics, Local↗

PubMed2001

Pro-apoptotic effect of presenilin 2 (PS2) overexpression is associated with down-regulation of Bcl-2 in cultured neurons.

Presenilin 2 (PS2) is a polytopic membrane protein that is mutated in some cases of familial Alzheimer's disease (AD). The normal functions of PS2 and its pathogenic role in AD remain unclear. We investigated the biological role of this protein in neurons, using adenovirus-mediated transduction of the PS2 gene into rat primary cortical neurons. Immunocytochemical analyses demonstrated increased PS2 immunoreactivity in most neurons infected with recombinant adenoviruses expressing PS2. Neurons infected with wild-type or mutant (N141I) PS2-expressing adenoviruses showed a significant increase in basal cell death, compared with those infected with control beta-galactosidase-expressing adenovirus. Moreover, PS2 overexpression markedly increased neuronal susceptibility to staurosporine-induced apoptosis. Mutant PS2 was more effective in enhancing apoptosis than its wild-type counterpart. Staurosporine-induced death was significantly inhibited by a specific caspase 3 inhibitor. Western analyses revealed that Bcl-2 protein expression was specifically down-regulated in neurons overexpressing PS2, which temporally corresponded to the accumulation of C- and N-terminal fragments of PS2. Additionally, expression of mutant, but not wild-type PS2, increased the production of beta-amyloid protein (Abeta) 42. These data collectively suggest that the pro-apoptotic effect of PS2 is mediated by down-regulation of Bcl-2. PS2 mutations may increase the susceptibility of neurons to apoptotic stimuli by perturbing the regulation of cell death.

Adenoviridae↗

PubMed2001

Clearance of extracellular and cell-associated amyloid beta peptide through viral expression of neprilysin in primary neurons.

Amyloid beta peptide (Abeta), the pathogenic agent of Alzheimer's disease (AD), is a physiological metabolite constantly anabolized and catabolized in the brain. We previously demonstrated that neprilysin is the major Abeta-degrading enzyme in vivo. To investigate whether or not manipulation of neprilysin activity in the brain would be an effective strategy for regulating Abeta levels, we expressed neprilysin in primary cortical neurons using a Sindbis viral vector and examined the effect on Abeta metabolism. The corresponding recombinant protein, expressed in the cell bodies and processes, exhibited thiorphan-sensitive endopeptidase activity, whereas a mutant neprilysin with an amino acid substitution in the active site did not show any such activity. Expression of the wild-type neprilysin, but not the mutant, led to significant decreases in both the Abeta40 and 42 levels in the culture media in a dose-dependent manner. Moreover, neprilysin expression also resulted in reducing cell-associated Abeta, which could be more neurotoxic than extracellular Abeta. These results indicate that the manipulation of neprilysin activity in neurons, the major source of Abeta in the brain, would be a relevant strategy for controlling the Abeta levels and thus the Abeta-associated pathology in brain tissues.

Amyloid beta-Peptides↗

PubMed2000

Mutational analysis of intrinsic regions of presenilin 2 that determine its endoproteolytic cleavage and pathological function.

To investigate the significance of endoproteolytic processing of presenilin 2 (PS2) on its pathological function, we constructed PS2 cDNAs causing amino acid substitutions or deletions around the cleavage site. We found that a PS2 mutant (Del3) with a 20-amino acid deletion was not endoproteolytically processed, while other PS2s with amino acid substitutions and short deletions were cleaved. Overproduction of all the mutant proteins led to a compensatory decrease of endogenous PS1 fragments, but did not affect the amyloid beta peptide X-42/Abeta X-40 ratio without the familial Alzheimer's disease mutation. The Del3 mutant did not exhibit significant deficits in gamma-secretase activity. The turnover rate of the Del3 holoprotein was the same as that of full-length PS2. These data suggest that the determinants of the PS2 cleavage site reside within a large region and that the pathological function of PS2 is exerted by familial Alzheimer's disease mutations not related to the cleavage of holoproteins. We also found that PS2 with an 18-amino acid deletion at the C-terminal end was not processed. Its overexpression led neither to diminished accumulation of endogenous PS1 fragments nor to increased production of amyloid beta peptide X-42. The C-terminal end of PS2 seems to possess the signal for entry into the processing pathway.

Alzheimer Disease↗

PubMed2000

Biochemical identification of the neutral endopeptidase family member responsible for the catabolism of amyloid beta peptide in the brain.

Amyloid beta peptide (Abeta) is a physiological peptide that is constantly catabolized in the brain. We previously demonstrated that an endopeptidase sensitive to phosphoramidon and thiorphan conducts the initial rate-limiting proteolysis of Abeta in vivo, but the exact molecular identity of the peptidase(s) has remained unknown because of the molecular redundancy of such activity. We analyzed the brain-derived enzyme by means of immuno-depletion and gene disruption, and demonstrate here that neprilysin accounts for the majority of the Abeta-degrading activity. Furthermore, kinetic analysis, giving a K(m) value of 2.8 +/- 0.76 microM, indicated that Abeta(1-42) is a relevant substrate for neprilysin.

Amino Acid Sequence↗

PubMed2000

Overexpression of presenilin-2 enhances apoptotic death of cultured cortical neurons.

Presenilin-2 (PS2) is a gene of unknown function linked with some forms of familial Alzheimer's disease. To investigate the biological role of PS2 in neurons, we overexpressed PS2 in primary cortical neurons using recombinant adenoviral vectors. Western blot and immunohistochemical analyses showed enhanced expression of PS2 proteins in infected neurons after infection of recombinant adenoviruses containing the human wild-type or mutant PS2 gene. Neuronal survival was decreased by approximately 30% in cultures infected with adenovirus expressing either wild-type or mutant PS2, as compared with those infected with adenovirus expressing the LacZ gene. Fragmented nuclei were frequently observed in dying neurons. These data suggest that apoptotic death of cultured cortical neurons is enhanced by PS2 overexpression.

Animals↗

PubMed1999

Effects of presenilin N-terminal fragments on production of amyloid beta peptide and accumulation of endogenous presenilins.

To clarify the effects of the proteolytic cleavage of presenilin 1 (PS1) and presenilin 2 (PS2) proteins on their functions, we established stable cell lines which expressed the physiologically cleaved N-terminal fragment (NTF) with or without mutations of familial Alzheimer's disease (FAD). We found that exogenous expression of the PS1-NTF or PS2-NTF harboring FAD mutations was insufficient for increased production of amyloidogenic A beta X-42 peptide and that the overexpressed NTFs had no effect on the accumulation of endogenous presenilin fragments.

Alzheimer Disease↗

PubMed1999

Transgenic mice with Alzheimer presenilin 1 mutations show accelerated neurodegeneration without amyloid plaque formation.

Familial Alzheimer disease mutations of presenilin 1 (PS-1) enhance the generation of A beta1-42, indicating that PS-1 is involved in amyloidogenesis. However, PS-1 transgenic mice have failed to show amyloid plaques in their brains. Because PS-1 mutations facilitate apoptotic neuronal death in vitro, we did careful quantitative studies in PS-1 transgenic mice and found that neurodegeneration was significantly accelerated in mice older than 13 months (aged mice) with familial Alzheimer disease mutant PS-1, without amyloid plaque formation. However, there were significantly more neurons containing intracellularly deposited A beta42 in aged mutant transgenic mice. Our data indicate that the pathogenic role of the PS-1 mutation is upstream of the amyloid cascade.

Age Factors↗

PubMed1998

Both N-terminal and C-terminal fragments of presenilin 1 colocalize with neurofibrillary tangles in neurons and dystrophic neurites of senile plaques in Alzheimer's disease.

Presenilin 1 (PS1) is a causative gene for chromosome 14-linked familial Alzheimer's disease. The gene product is known to be cleaved into N-terminal fragments (PS1-N) and C-terminal fragments (PS1-C). To understand the pathophysiological role of PS1, we conducted immunohistochemical studies using antibodies specific for PS1-N and PS1-C in sporadic Alzheimer's disease (AD). Both antibodies showed punctuate staining exclusively in neurons and their processes in both control and AD brains. PS1-N immunolabeling colocalized with neurofibrillary tangles (NFTs) in 36% of NFT-bearing neurons and with dystrophic neurites in 28% of senile plaques (SPs). PS1-C immunolabeling colocalized with dystrophic neurites in 70% of NFT-bearing SPs and with intraneuronal NFTs in 32% of NFT-bearing neurons. Both antibodies did not detect PHF-tau-positive neuropil threads and Abeta amyloid fibrils. The colocalization was also found in 33-38 % of NFT-bearing neurons in progressive supranuclear palsy. These results indicate that both PS1-N and PS1-C fragments are deposited in part of NFT-bearing neurons and dystrophic neurites in SPs; both are the pathologic hallmarks of AD.

Alzheimer Disease↗

PubMed1998

Multiple actions of nitric oxide on voltage-dependent Ca2+ channels in mouse cerebral cortical neurons.

We investigated the effects of nitric oxide (NO) on voltage-dependent Ca2+ channels (VDCCs) by examining [45Ca2+]influx into mouse cerebral cortical neurons. S-nitroso-N-acetylpenicillamine (SNAP) induced a dose-dependent increase in [45Ca2+]influx, which was completely abolished by hemoglobin, tetrodotoxin and dibucaine. The NO-induced [45Ca2+influx was significantly inhibited by verapamil and omega-agatoxin VIA (omega-AGX), whereas omega-conotoxin GVIA (omega-CTX) had no effects on the NO-induced [45Ca2+]influx. KCl (30 mM) stimulated [45Ca2+]influx, and verapamil, omega-CTX and omega-AGX reduced the KCl-induced [45Ca2+]influx by about 40, 26 and 34%, respectively, indicating that the neurons used here possess L-, N- and P-typed VDCCs. SNAP itself reduced KCl-induced [45Ca2+]influx by about 28.5%. In the presence of both KCl and SNAP, omega-CTX showed no effects on the influx, while verapamil and omega-AGX significantly inhibited the influx and the concomitant presence of verapamil and omega-AGX completely abolished the influx. These results indicate that NO induces [45Ca2+] influx via the opening of L- and P-typed VDCCs subsequent to neuronal membrane depolarization and that NO itself inhibited the function of N-typed VDCC in the cerebral cortical neurons.

Animals↗

PubMed1998

Mechanisms for facilitation of nitric oxide-evoked [3H]GABA release by removal of hydroxyl radical.

We have investigated the mechanisms for enhancement of nitric oxide (NO)-evoked gamma-[3H]aminobutyric acid ([3H]GABA) release from mouse cerebrocortical neurons by hydroxyl radical (.OH) scavengers. .OH scavengers, such as N,N'-dimethylthiourea (DMTU), uric acid, and mannitol, dose-dependently facilitated NO-evoked [3H]GABA release evoked by NO liberated from S-nitroso-N-acetylpenicillamine. Ionomycin-evoked [3H]GABA release, which was significantly inhibited by hemoglobin and an NO synthase, N(G)-methyl-L-arginine, was also enhanced by DMTU. These results indicate that GABA release evoked by both endogenous and exogenous NO is facilitated by .OH scavengers. These enhancing actions of .OH scavengers were completely abolished by Ca2+ removal from incubation buffer and by an L-type voltage-dependent Ca2+ channel (VDCC) inhibitor, nifedipine, whereas each .OH scavenger showed no effects on [3H]GABA release in the absence of NO. Inhibitors for P/Q- and N-type VDCCs had no effects on the enhancement. NO-induced 45Ca2+ influx was also dose-dependently enhanced by .OH scavengers, although 45Ca2+ influx was not altered by .OH scavengers in the absence of NO. Nifedipine abolished this enhancement of the NO-induced 45Ca2+ influx by .OH scavengers. These results indicate that the removal of .OH by its scavengers facilitates the NO-evoked [3H]GABA release dependent on Ca2+ and that this enhancement is due to the increase in Ca2+ influx via L-type VDCCs.

Animals↗

PubMed1998

Purification of nuclear proteins that potentially regulate transcription of the MUC1 mucin gene induced by a soluble factor.

Transcriptional regulation of the MUC1 mucin gene in KM12C human colon carcinoma cells, which is induced by a soluble stimulatory factor derived from normal colonic connective tissues, was investigated. The minimum responsive element that was sufficient for this upregulation by the soluble factor is the upstream sequence of the MUC1 mucin gene from -531 to -488. Several factors in nuclear extracts of KM12C cells bound to this sequence in gel retardation assays. Neither the quantities nor the mobilities of the retarded bands changed on treatment with the soluble factor. Mutagenesis within the region from ACAGGGAGCGGTTAGAAGGGTGGGGCTATTCCGGGAAGTGGTGG to ACAGGGAGCGGTTAGAA[TTT]TGGGGCTATTCCGGGAAGTGGTGG (bracketed letters were mutated) substantially decreased the induction of the MUC1 mucin gene by the soluble factor. Two retarded bands were observed when the unmutated sequence was used as a probe; the bands disappeared when the mutated sequence was used as a probe. These results indicate that factors corresponding to each band were responsible for the upregulation of the MUC1 mucin gene, although the quantities of these proteins and their affinity to the nucleotide sequence did not change during the induction. Purification of the protein components comprising each band by a combination of column chromatographies indicated that one band contained four proteins (111, 106, 101, and 95 kDa) and the other consisted of two proteins (66 and 64 kDa).

Base Sequence↗

PubMed1997

Determination of a cleavage site of presenilin 2 protein in stably transfected SH-SY5Y human neuroblastoma cell lines.

Mutations in the presenilin 1 (PS1) and presenilin 2 (PS2) genes are associated with early-onset autosomal dominant familial Alzheimer's disease, and the gene products are endoproteolytically processed to yield N-terminal fragments (NTF) and C-terminal fragments (CTF). We have studied the cleavage site of the PS2 protein in stably transfected human neuroblastoma cells. The 23 kD PS2-CTF was isolated by a combination of anion exchange chromatography and affinity chromatography and directly sequenced. The N-terminus of the PS2-CTF started at residue 307, which indicated that the cleavage occurs between Lys306 and Leu307 in the proximal portion of the large hydrophilic loop. This site is close to the cleavage positions observed in the PS1 protein.

Alzheimer Disease↗