PubMed Health⌕ Search

Biomedical subjects

L C Yu

Publications and source records attributed to L C Yu.

At least 127 records · Page 7Linked to original sources

The Job Context Index: a guide for improving the 'fit' between nurses and their work environment.

Stress and burnout have reached crisis levels among hospital nurses. The authors of this paper address this problem with the development of a scale to improve the 'fit' between a nurse and his/her work environment, thereby potentially increasing satisfaction, and reducing stress and burnout. Approximately 1000 hospital nurses, randomly selected from a large eastern state, described their work in each of 10 clinical areas; their reports enabled the construction of the Job Context Index, which rank orders the 10 settings on three dimensions, including general work pressure/uncertainty, routinization of tasks, and co-worker interdependence. Nurses, as well as educators and administrators, may find their index a useful tool for matching nurses' temperaments and workstyles with the characteristics of the clinical areas in which they might be working.

Burnout, Professional↗

Involvement of arcuate nucleus of hypothalamus in the descending pathway from nucleus accumbens to periaqueductal grey subserving an antinociceptive effect.

The present study was performed to explore the possible involvement of the arcuate nucleus of hypothalamus (ARH) and beta-endorphinergic pathway in the connection from nucleus accumbens to periaqueductal grey (PAG). It was found that the analgesic effect of morphine administered to nucleus accumbens of the rabbit was significantly attenuated by the antiserum against beta-endorphin (beta-EP) injected into PAG. The antagonistic effect was totally abolished by lesioning of the ARH. However, in the rabbit with ARH lesioning, no significant change in basal nociceptive threshold was seen nor was there any significant change in the efficacy of analgesia induced by injecting morphine into nucleus accumbens. The latter effect was attenuated by intra-PAG-administered naloxone, as in the normal control rabbits. These results indicate that (1) ARH and its efferent beta-endorphinergic fibers are involved in the descending pathway from the nucleus accumbens to PAG, subserving an antinociceptive effect, (2) endogenous opioid peptides other than beta-EP seem to play an equally important role in mediating analgesia.

Analgesia↗

The ISQ-P tool: measuring stress associated with incontinence.

1. ISQ-P is a useful tool in measuring psychological stress associated with urinary incontinence. 2. ISQ-P can be used in conjunction with bladder training programs. 3. Patients with urinary incontinence show depressive symptoms, have somatic concerns regarding urinary incontinence, and exhibit a feeling of shame.

Aged↗

Occupational stress among nurses in hospital settings.

1. This study provides empirical evidence for the repeated statements by hospital nurses that their work situation is overwhelmingly stressful. 2. Stress seems to arise from the overall complexity of nurses' work rather than specific tasks required of nurses. 3. Stressors are uniform across clinical areas, especially with regard to perceived work pressure. 4. Among the most frequently cited stressors for nurses in nearly every hospital setting were "keeping track of many things"; "It is hard to predict what will happen each day"; and "Simple mistakes could have dire consequences."

Adult↗

Pernicious anemia and juvenile-onset diabetes mellitus in an adolescent: a case report.

We report a case of a 15-year-old black boy who developed juvenile-onset pernicious anemia in association with insulin-dependent diabetes mellitus. He had both intrinsic factor and parietal cell antibodies in addition to anti-islet cell surface antibodies. The existence of pernicious anemia and diabetes mellitus in such a young child makes this an unusual case.

Adolescent↗

Application of flow karyotyping in prenatal detection of chromosome aberrations.

This paper describes the application of bivariate flow karyotyping to (1) classification of chromosomes isolated from cultures of cells taken by amniocentesis and (2) detection of numerical and structural aberrations. Chromosomes were isolated from primary cultures 2-5 wk after amniocentesis, stained with Hoechst 33258 and chromomycin A3, and analyzed using dual beam flow cytometry. Information about chromosome DNA content and DNA base composition was derived from the locations of the peaks in the flow karyotypes, each peak being produced by one or more chromosome types with similar DNA content and DNA base composition. Information about the relative frequency of each chromosome type was determined on the basis of the relative volume of the peak for that chromosome type. Cytogenetic information determined on the basis of flow karyotypes was compared with that obtained by visual analysis following G-banding. Variability among the peak means and volumes in flow karyotypes was determined from analyses of 50 normal amniocyte cultures. Numerical aberrations involving chromosomes 21, 18, and Y were detected correctly in all of 28 analyses, including eight in a blind study. Structural aberrations involving chromosomes 1, 2, 3, 6, 9-12, 13, 14, 15, 21, and 22 were detected in all of seven cultures in a blind study. Flow karyotypes proved to be insensitive to small, normally occurring chromosome polymorphisms detected by banding analysis. In addition, a few samples were erroneously scored as having numerical aberrations.

Cells, Cultured↗

Stabilization of chromosomes by DNA intercalators for flow karyotyping and identification by banding of isolated chromosomes.

A number of structurally unrelated DNA intercalators have been studied as stabilizers of mitotic chromosomes during isolation from rodent and human metaphase cells. Seven out of the nine intercalators tested were found to be useful as chromosome stabilizing agents. Chromosome suspensions prepared in this way could be preserved for long periods of time. After isolation the chromosomal DNA was longer than 150 kb. With intercalated chromosomes high resolution flow karyotypes could be obtained as illustrated for the non-fluorescent intercalators 9-methylene-(1,3-dimethyl-2,4-dionepyrimidine-5-yl)-phenanthrid in iumchloride and 4'-aminomethyl-4,5', 8-trimethylpsoralen combined with DAPI and 33258 Hoeschst for fluorescent staining and for the fluorescent intercalator propidium iodide used as a stabilizer and as a fluorochrome. Passage of the intercalated chromosomes through the laser beam had no measurable effect on the length of the chromosomal DNA subsequently isolated. After flow analysis and collection on slides human chromosomes could easily be banded by Giemsa staining methods with the same resolution as obtained in conventional metaphase spreads. This allowed a ready identification of about 80 percent of all chromosomes in the unfractionated suspension collected after passage through the laser beam.

Animals↗

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac.

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.

Animals↗

Ca2+-sensitive cross-bridge dissociation in the presence of magnesium pyrophosphate in skinned rabbit psoas fibers.

We find that at 6 degrees C in the presence of 4 mM MgPPi, at low or moderate ionic strength, skinned rabbit psoas fibers exhibit a stiffness and an equatorial x-ray diffraction pattern similar to that of rigor fibers. As the ionic strength is increased in the absence of Ca2+, both the stiffness and the equatorial x-ray diffraction pattern approach those of the relaxed state. This suggests that, as in solution, increasing ionic strength weakens the affinity of myosin cross-bridges for actin, which results in a decrease in the number of cross-bridges attached. The effect is Ca2+-sensitive. Assuming that stiffness is a measure of the number of cross-bridge heads attached, in the absence of Ca2+, the fraction of attached cross-bridge heads varies from approximately 75% to approximately 25% over an ionic strength range where ionic strength in solution weakens the binding constant for myosin subfragment-1 binding to unregulated actin by less than a factor of 3. Therefore, this phenomenon appears similar to the cooperative Ca2+-sensitive binding of S1 to regulated actin in solution (Greene, L. E., and E. Eisenberg, 1980, Proc. Natl. Acad. Sci. USA, 77:2616). By comparing the binding constants in solution and in the fiber under similar conditions, we find that the "effective actin concentration," that is, the concentration that gives the same fraction of S1 molecules bound to actin in solution as cross-bridge heads are bound to actin in a fiber, is in the millimolar range. An effective actin concentration in the millimolar range suggests that the strength of actin binding to cross-bridges in fibers may be several orders of magnitude weaker than the strength of ATP binding. Previously, it has been assumed that these two quantities were equal, as this gives the minimum energy loss when ATP dissociates the cross-bridge from actin (Morales, 1980, J. Supramol. Struct., 3:105:1975; Eisenberg, E.,Hill, T. L. and Y. Chen, 1980, Biophys. J., 29:195).

Actins↗

Infective endocarditis following cardiac catheterization in infancy. A case report and review.

A 4.5-month-old infant with transposition of great vessels and large ventricular septal defect developed acute infective endocarditis following cardiac catheterization. Beta-hemolytic streptococcus was recovered from three blood cultures. The infant survived after 6 weeks intravenous antibiotic therapy. The occurrence of infective endocarditis following cardiac catheterization during infancy is briefly reviewed and discussed. The importance of distinguishing febrile episodes of infancy from infective endocarditis and the use of two-dimensional echocardiography for diagnosis is re-emphasized.

Cardiac Catheterization↗

Preparation and bivariate analysis of suspensions of human chromosomes.

Chromosomes were isolated from a variety of human cell types using a HEPES-buffered hypotonic solution (pH 8.0) containing KCl, MgSO4, dithioerythritol, and RNase. The chromosomes isolated by this procedure could be stained with a variety of fluorescent stains including propidium iodide, chromomycin A3, and Hoechst 33258. Addition of sodium citrate to the stained chromosomes was found to improve the total fluorescence resolution. High-quality bivariate Hoechst vs. chromomycin fluorescence distributions were obtained for chromosomes isolated from a human fibroblast cell strain, a human colon carcinoma cell line, and human peripheral blood lymphocyte cultures. Good flow karyotypes were also obtained from primary amniotic cell cultures. The Hoechst vs. chromomycin flow karyotypes of a given cell line, made at different times and at dye concentrations varying over fourfold ranges, show little variation in the relative peak positions of the chromosomes. The size of the DNA in chromosomes isolated using this procedure ranges from 20 to over 50 kilobases. The described isolation procedure is simple, it yields high-quality flow karyotypes, and it can be used to prepare chromosomes from clinical samples.

Bisbenzimidazole↗

Equatorial x-ray diffraction from single skinned rabbit psoas fibers at various degrees of activation. Changes in intensities and lattice spacing.

Equatorial x-ray diffraction patterns were obtained from single skinned rabbit psoas fibers during various degrees of activation under isometric conditions at ionic strength 170 mM and 6-9 degrees C. By direct calcium activation, contraction was homogeneous throughout the preparation, and by using a cycling technique (Brenner, 1983) integrity of the fiber was maintained even during prolonged steady activation. The intensity ratio of the two innermost reflections I11/I10, and the normalized intensities I*10 and I*11 varied linearly with increasing force. Thus the result agreed qualitatively with an earlier finding, obtained from the whole sartorius muscle, that intensity changes in 10 and 11 are directly correlated with isometric force level (Yu et al., 1979). Spacing of the myofilament lattice (d10) was found to decrease with increasing isometric tension. With the filaments in full overlap, maximum shrinkage was 14%. The lattice spacing started to level off when the degree of calcium activation was greater than or equal to 50%, approaching a limit approximately at 380-360 A. This decrease of the lattice spacing indicates that there is a radial force produced by force generating cross-bridges, but the net radial force appears to become insignificant as lattice spacing approaches 380-360 A.

Animals↗