PubMed Health⌕ Search

Biomedical subjects

L G Shaffer

Publications and source records attributed to L G Shaffer.

At least 37 records · Page 2Linked to original sources
PubMed2001

Trisomy 17p10-p12 resulting from a supernumerary marker chromosome derived from chromosome 17: molecular analysis and delineation of the phenotype.

We report a 5-year-old boy with a small de novo marker chromosome derived from the proximal short arm of chromosome 17. His clinical features include hypotonia, global developmental delay, oval face with large nose and prominent ears, and ligamentous laxity of the fingers. Magnetic resonance imaging of the brain demonstrated mildly delayed myelination. G-band chromosome analysis revealed mosaicism for a small marker chromosome in 85% of the peripheral blood cells analyzed. Fluorescence in situ hybridization and microsatellite polymorphism studies showed that the der(17) was of maternal origin and included genetic material from the 17p10-p12 region, but did not contain the PMP22 gene. One breakpoint mapped within the centromere and the second breakpoint mapped adjacent to the Charcot-Marie-Tooth disease type 1A proximal low-copy repeat (CMT1A-REP). We compare the clinical characteristics of our patient with those previously reported to have a duplication involving the proximal short arm region of chromosome 17 to further delineate the phenotype of trisomy 17pl0-p12.

Charcot-Marie-Tooth Disease↗
PubMed2001

Familial case of Potocki-Shaffer syndrome associated with microdeletion of EXT2 and ALX4.

Multiple exostosis, biparietal foramina, minor craniofacial abnormalities, and mental retardation are characteristic of the syndrome associated with a proximal deletion of 11p (MIM # 601224), which has been shown to be a true contiguous gene deletion syndrome. The presence of multiple exostosis is associated with deletion of the EXT2 gene. Similarly, the presence of biparietal foramina has been shown to be associated with the deletion of ALX4 located proximally to EXT2. Specific genes related to mental retardation and craniofacial abnormalities, however, have yet to be identified. We report on a family with a microdeletion of 11(pll.2p11.2) with multiple exostosis and biparietal foramina without mental retardation or craniofacial abnormalities. Our results suggest that genes related to mental retardation and craniofacial development must be located outside of the D11S1785-D11S1385 region.

Child↗
PubMed2001

Prenatal ultrasound findings in a fetus with paternal uniparental disomy 14q12-qter.

We present the prenatal ultrasound findings in a case of postnatally identified paternal uniparental isodisomy 14q12-qter. Increased nuchal translucency and a large omphalocele were identified at 14 weeks' gestation. Karyotyping revealed a normal male, 46,XY. As gestation advanced, polyhydramnios developed, skeletal abnormalities involving the long bones and chest became evident, hand contractures developed, and the presumed large omphalocele was in part found to be a large ventral hernia, as echogenic adipose tissue could be seen in the abdominal wall near to the cord insertion. Prenatal findings were confirmed after delivery and central nervous system imaging revealed lissencephaly. The combination of an abdominal wall defect with either increased nuchal translucency or skeletal abnormalities should prompt an investigation for uniparental disomy 14 even if the karyotype is normal.

Abnormalities, Multiple↗
PubMed2001

Loss of the potassium channel beta-subunit gene, KCNAB2, is associated with epilepsy in patients with 1p36 deletion syndrome.

PURPOSE: Clinical features associated with chromosome 1p36 deletion include characteristic craniofacial abnormalities, mental retardation, and epilepsy. The presence and severity of specific phenotypic features are likely to be correlated with loss of a distinct complement of genes in each patient. We hypothesize that hemizygous deletion of one, or a few, critical gene(s) controlling neuronal excitability is associated with the epilepsy phenotype. Because ion channels are important determinants of seizure susceptibility and the voltage-gated K(+) channel beta-subunit gene, KCNAB2, has been localized to 1p36, we propose that deletion of this gene may be associated with the epilepsy phenotype. METHODS: Twenty-four patients were evaluated by fluorescence in situ hybridization with a probe containing KCNAB2. Clinical details were obtained by neurologic examination and EEG. RESULTS: Nine patients are deleted for the KCNAB2 locus, and eight (89%) of these have epilepsy or epileptiform activity on EEG. The majority of patients have a severe seizure phenotype, including infantile spasms. In contrast, of those not deleted for KCNAB2, only 27% have chronic seizures, and none had infantile spasms. CONCLUSIONS: Lack of the beta subunit would be predicted to reduce K(+) channel-mediated membrane repolarization and increase neuronal excitability, suggesting a possible relation between loss of this gene and the development of seizures. Because some patients with seizures were not deleted for KCNAB2, there may be additional genes within 1p36 that contribute to epilepsy in this syndrome. Hemizygosity of this gene in a majority of monosomy 1p36 syndrome patients with epilepsy suggests that haploinsufficiency for KCNAB2 is a significant risk factor for epilepsy.

Adolescent↗
PubMed2000

Haploinsufficiency of ALX4 as a potential cause of parietal foramina in the 11p11.2 contiguous gene-deletion syndrome.

Heterozygous mutations in MSX2 are responsible for an autosomal dominant form of parietal foramina (PFM). PFM are oval defects of the parietal bones that are also a characteristic feature of a contiguous gene-deletion syndrome caused by a proximal deletion in the short arm of chromosome 11 (Potocki-Shaffer syndrome). We have identified a human bacterial artificial chromosome (BAC) clone mapping to chromosome 11, containing a region homologous to the human homeobox gene MSX2. Further sequence analysis demonstrated that the human orthologue (ALX4) of the mouse Aristaless-like 4 gene (Alx4) is contained within this 11p clone. We used FISH to test for the presence-or for the heterozygous deletion-of this clone in two patients with the 11p11.2-deletion syndrome and showed that this clone is deleted in these patients. ALX4 and Alx4 were shown to be expressed in bone and to be absent from all other tissues tested. The involvement of Alx4 in murine skull development, its bone-specific expression pattern, the fact that Alx4 is a dosage-sensitive gene in mice, and the localization of a human genomic clone containing ALX4 to 11p11.2, with hemizygosity in patients with deletion of 11p11.2 who have biparietal foramina, support the contention that ALX4 is a candidate gene for the PFM in the 11p11.2-deletion syndrome.

Amino Acid Sequence↗
PubMed2000

Search for imprinted regions on chromosome 14: comparison of maternal and paternal UPD cases with cases of chromosome 14 deletion.

Over the past few years, regions of genomic imprinting have been identified on a small number of chromosomes through a search for the etiology of various disorders. Distinct phenotypes have been associated with both maternal and paternal uniparental disomy (UPD) for chromosome 14. This observation indicates that there are imprinted genes present on chromosome 14, although none have been identified to date. In order to focus the search for imprinted genes on chromosome 14, we analyzed cases of maternal and paternal UPD 14 and compared them with cases of chromosome 14 deletions. Cases of paternal UPD were compared with maternal deletions and maternal UPD compared with paternal deletions. The paternal UPD anomalies seen in maternal deletion cases allowed us to associate the following features and chromosomal regions: Hirsute forehead: del(14)(q12q13. 3) and del(14)(q32); blepharophimosis: del(14)(q32); small thorax: del(14)(q11.2q13); and joint contractures: del(14)(q11.2q13) and del(14)(q31). Comparison of maternal UPD and paternal deletion cases revealed fleshy nasal tip to be most often associated with del(14)(q32), scoliosis with del(14) (q23q24.2), and del(14)(q32. 11qter) and small size at birth to be associated with del(14)(q11q13) and del(14)(q32). Our study, in conjunction with a prior study of UPD 14 and partial trisomy 14 cases, and what is known of imprinting in regions of mouse chromosomes homologous to human chromosome 14, leads us to conclude that 14q23-q32 is likely an area where imprinted genes may reside.

Abnormalities, Multiple↗
PubMed2000

Molecular cloning, expression analysis, and chromosome mapping of WDR6, a novel human WD-repeat gene.

The WD-repeat proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as signal transduction, transcription, and proliferation. Here we report on the cloning and characterization of a novel human WD-repeat gene, WDR6, which encodes a protein of 1121 amino acids and contains 11 WD-repeat units. WDR6 is unique since its 11 WD repeats are clustered into two distinct groups separated by a putative transmembrane domain. The WDR6 gene was mapped to chromosome 15q21 by fluorescence in situ hybridization. Northern analysis demonstrated that WDR6 is ubiquitously expressed in human adult and fetal tissues. WDR6 is not homologous to any previously identified human WD-repeat genes including WDR1 through WDR5. However, it was found to have significant sequence similarity with Arabidopsis thaliana hypothetical protein T7B11.12, yeast putative elongation factor G, and probable membrane protein YPL183c. All of them have been defined as WD-repeat proteins. Therefore, WDR6 is a novel protein and probably belongs to a highly conserved subfamily of WD-repeat proteins in which T7B11.12 and YPL183c are its distantly related members.

Amino Acid Sequence↗
PubMed2000

Isolation and preliminary characterization of the human and mouse homologues of the bacterial cell cycle gene era.

Era is an essential GTPase that is required for proper cell cycle progression and cell division in Escherichia coli and is found in nearly all bacteria sequenced to date. To determine whether Era is also present in eukaryotic organisms, we searched the dbEST database and found EST clones coding for proteins that were similar to Era. Full sequencing of these ESTs from human and mouse identified a conserved homologue, ERAL1 (Era-like 1). ERAL1 maps to 17q11.2 in human and is located in the syntenic region of mouse chromosome 11. ERAL1 may be an attractive candidate for a tumor suppressor gene since ERAL1 is located in a chromosomal region where loss of heterozygosity is often associated with various types of cancer.

Amino Acid Sequence↗
PubMed2000

Detection of a cryptic translocation in a family with mental retardation using FISH and telomere region-specific probes.

Cryptic rearrangements involving the telomeres are thought to account for a substantial number of patients with unexplained mental retardation and multiple congenital anomalies, although the exact incidence of these rearrangements is still unclear. With the advent of chromosome-specific telomeric probes and the use of FISH (fluorescence in situ hybridization), it is now possible to identify submicroscopic rearrangements of the distal ends of chromosomes that may otherwise go undetected using conventional cytogenetic studies. We report on a 4 1/2 year-old girl with severe mental retardation and minor anomalies who inherited the unbalanced product of a cryptic translocation involving chromosomes 2 and 17 from her father. The family history was significant for early pregnancy losses, stillbirths, and mental retardation in many other family members, suggesting segregation of a familial translocation. This translocation was detected using chromosome-specific telomere FISH probes, and not visible using conventional cytogenetic methods. Collectively, this case and those previously reported clearly demonstrate the value of a systematic search for cryptic chromosome rearrangements in patients with unexplained mental retardation with previously reported normal chromosome studies; and in particular those with a family history of mental retardation, birth defects, or early pregnancy losses.

Adolescent↗
PubMed2000

Identification of Y chromatin directly in gonadal tissue by fluorescence in situ hybridization (FISH): significance for Ullrich-Turner syndrome screening in the cytogenetics laboratory.

The presence of Y chromatin in individuals with Ullrich-Turner syndrome (UTS) confers a risk for gonadoblastoma. In mosaic cases, little is known about Y chromatin distribution in gonads. Fluorescence in situ hybridization (FISH) is a direct approach to assess the extent of Y chromatin mosaicism in gonads. Gonadal tissue from four patients with mosaic karyotypes were analyzed by routine cytogenetics and FISH with X and Y centromere probes. Y chromatin was present in gonads in varying percentages in these patients. The distribution of Y chromatin in gonads of UTS individuals did not completely correlate with that found in blood lymphocytes. The finding of Y chromatin in the blood samples from these patients prompted the development of a screening strategy in our cytogenetics laboratory to detect low-level Y chromatin mosaicism in patients with UTS.

Adolescent↗
PubMed2000

Identification of uniparental disomy following prenatal detection of Robertsonian translocations and isochromosomes.

Rearrangements of the acrocentric chromosomes (Robertsonian translocations and isochromosomes) are associated with an increased risk of aneuploidy. Given this, and the large number of reported cases of uniparental disomy (UPD) associated with an acrocentric rearrangement, carriers are presumed to be at risk for UPD. However, an accurate risk estimate for UPD associated with these rearrangements is lacking. A total of 174 prenatally identified acrocentric rearrangements, including both Robertsonian translocations and isochromosomes, were studied prospectively to identify UPD for the chromosomes involved in the rearrangements. The overall goal of the study was to provide an estimate of the risk of UPD associated with nonhomologous Robertsonian translocations and homologous acrocentric rearrangements. Of the 168 nonhomologous Robertsonian translocations studied, one showed UPD for chromosome 13, providing a risk estimate of 0.6%. Four of the six homologous acrocentric rearrangements showed UPD, providing a risk estimate of 66%. These cases have also allowed delineation of the mechanisms involved in producing UPD unique to Robertsonian translocations. Given the relatively high risk for UPD in prenatally identified Robertsonian translocations and isochromosomes, UPD testing should be considered, especially for cases involving the acrocentric chromosomes 14 and 15, in which UPD is associated with adverse clinical outcomes.

Aneuploidy↗
PubMed2000

Characterization of human retinal fascin gene (FSCN2) at 17q25: close physical linkage of fascin and cytoplasmic actin genes.

Retinal fascin is a newly identified photoreceptor-specific paralog of the actin-bundling protein fascin. Fascins crosslink f-actin into highly ordered bundles within dynamic cell extensions such as neuronal growth cone filopodia. We have isolated cDNA and genomic clones of human retinal fascin and characterized the structure of the human retinal fascin gene (FSCN2). The cDNA predicts a protein of 492 amino acids and molecular mass 55,057 that shows 94% identity to bovine retinal fascin and 56% identity to human fascin. Promoter analysis reveals a consensus retinoic acid response element and several potential binding sites for transcription factors Crx and Nrl, which correlates with the retina-specific expression of FSCN2 mRNA. Fluorescence in situ hybridization analysis and genomic clone sequencing indicate that the FSCN2 gene lies within 200 kb of the actin gene ACTG1 at 17q25. Database searches revealed that the human fascin gene FSCN1 and actin gene ACTB at 7p22 also coexist within a 200-kb genomic clone. The close physical linkage of these fascin/actin gene pairs suggests that they derive from a common gene duplication event and allows comparison of fascin and actin phylogenetic analyses. Finally, a possible link to the retinitis pigmentosa 17 allele (RP17) at distal 17q was excluded by demonstration of multiple independent segregation events in two RP17 kindreds. Informative FSCN2 polymorphisms were identified and will serve as useful markers in future linkage studies. The likely function of retinal fascin, in light of known fascin roles in other cell types, is to assemble actin microfilaments in support of photoreceptor disk morphogenesis.

Actins↗
PubMed2000

Dual-probe fluorescence in situ hybridization assay for detecting deletions associated with VCFS/DiGeorge syndrome I and DiGeorge syndrome II loci.

Over 90% of patients with DiGeorge syndrome (DGS) or velocardiofacial syndrome (VCFS) have a microdeletion at 22q11.2. Given that these deletions are difficult to visualize at the light microscopic level, fluorescence in situ hybridization (FISH) has been instrumental in the diagnosis of this disorder. Deletions on the short arm of chromosome 10 are also associated with a DGS-like phenotype. Since deletions at 22q11.2 and at 10p13p14 result in similar findings, we have developed a dual-probe FISH assay for screening samples referred for DGS or VCFS in the clinical laboratory. This assay includes two test probes for the loci, DGSI at 22q11.2 and DGSII at 10p13p14, and centromeric probes for chromosomes 10 and 22. Of 412 patients tested, 54 were found to be deleted for the DGSI locus on chromosome 22 (13%), and a single patient was found deleted for the DGSII locus on chromosome 10 (0. 24%). The patient with the 10p deletion had facial features consistent with VCFS, plus sensorineural hearing loss, and renal anomalies. Cytogenetic analysis showed a large deletion of 10p [46, XX,del(10)(p12.2p14)] and FISH using a 10p telomere region-specific probe confirmed the interstitial nature of the deletion. Analysis for the DGSI and the DGSII loci suggests that the deletion of the DGSII locus on chromosome 10 may be 50 times less frequent than the deletion of DGSI on chromosome 22. The incidence of deletions at 22q11.2 has been estimated to be 1 in 4000 newborns; therefore, the deletion at 10p13p14 may be estimated to occur in 1 in 200,000 live births.

Chromosome Deletion↗
PubMed2000

Deletion (9) (p13.1 p21.1).

We report on a 22-month-old girl with minor facial anomalies, global developmental delay, growth retardation, seizures, and leukoencephalopathy. Initial clinical assessment suggested the diagnosis of Williams syndrome. Results of fluorescence in situ hybridization testing for elastin were normal. However, chromosome analysis showed a 46,XX,del(9)(p13.1p21.1) karyotype in peripheral lymphocytes. Parental chromosomes were normal, indicating a de novo deletion. This patient's manifestations are compared with those of two other cases with overlapping deletions of the proximal short arm of chromosome 9.

Chromosome Banding↗
PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗
PubMed2000

Molecular mechanism for duplication 17p11.2- the homologous recombination reciprocal of the Smith-Magenis microdeletion.

Recombination between repeated sequences at various loci of the human genome are known to give rise to DNA rearrangements associated with many genetic disorders. Perhaps the most extensively characterized genomic region prone to rearrangement is 17p12, which is associated with the peripheral neuropathies, hereditary neuropathy with liability to pressure palsies (HNPP) and Charcot-Marie-Tooth disease type 1A (CMT1A;ref. 2). Homologous recombination between 24-kb flanking repeats, termed CMT1A-REPs, results in a 1.5-Mb deletion that is associated with HNPP, and the reciprocal duplication product is associated with CMT1A (ref. 2). Smith-Magenis syndrome (SMS) is a multiple congenital anomalies, mental retardation syndrome associated with a chromosome 17 microdeletion, del(17)(p11.2p11.2) (ref. 3,4). Most patients (>90%) carry deletions of the same genetic markers and define a common deletion. We report seven unrelated patients with de novo duplications of the same region deleted in SMS. A unique junction fragment, of the same apparent size, was identified in each patient by pulsed field gel electrophoresis (PFGE). Further molecular analyses suggest that the de novo17p11.2 duplication is preferentially paternal in origin, arises from unequal crossing over due to homologous recombination between flanking repeat gene clusters and probably represents the reciprocal recombination product of the SMS deletion. The clinical phenotype resulting from duplication [dup(17)(p11.2p11.2)] is milder than that associated with deficiency of this genomic region. This mechanism of reciprocal deletion and duplication via homologous recombination may not only pertain to the 17p11.2 region, but may also be common to other regions of the genome where interstitial microdeletion syndromes have been defined.

Abnormalities, Multiple↗
PubMed2000

Identification of female carriers for Duchenne and Becker muscular dystrophies using a FISH-based approach.

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are X-linked recessive neuromuscular diseases caused by dystrophin gene mutations. Deletions, or more rarely duplications, of single or multiple exons within the dystrophin gene can be detected by current molecular methods in approximately 65% of DMD patients. Mothers of affected males have a two-thirds chance of carrying a dystrophin mutation, whilst approximately one-third of affected males have de novo mutations. Currently, Southern blot analysis and multiplex PCR directed against exons in deletion hot spots are used to determine female carrier status. However, both of these assays depend on dosage assessment to accurately identify carriers since, in females, the normal X chromosome is also present. To obviate quantitation of gene dosage, we have developed exon-specific probes from the dystrophin gene and applied them to a screen for potential carrier females using fluorescence in situ hybridization (FISH). Cosmid clones, representing 16 exons, were identified and used in FISH analysis of DMD/BMD families. Our preliminary work has identified multiple, informative probes for several families with dystrophin deletions and has shown that a FISH-based assay can be an effective and direct method for establishing the DMD/BMD carrier status of females.

Dystrophin↗