Studies on the polymorphisms of Pi, Bf, Gm serum levels of immunoglobulins and complement components in patients with Down's syndrome and other diseases.
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to L Hirth.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
We report a case of malignant hyperthermia in a man of 41 years during his 13th general anaesthesia. All previous anaesthetics were quite normal. Musculoskeletal abnormalities and increased CPK-levels are to be found in some members of the patient's family. The combined use of suxamethonium and halothane might have caused the development of malignant hyperthermia. As a concept of the aetiology of the syndrome the case history indicates that it may be stress-related.
Protein fluorescence properties of tobacco mosaic virus [3 Trp residues per monomer (positions 17, 52, 152)] and of two tobacco mosaic virus mutants [green tomato atypical mosaic virus, 2 Trp (52, 152) and cucumber virus4, 1 Trp (unknown position)] have been studied. Emission spectra, fluorescence quantum yields and lifetimes were determined. Results showed that protein fluorescence is due to buried Trp only, except for the cucumber virus4 strain, in which Tyr also contributed to the emission. Comparison of the three strains showed that Trp 17 and Trp 52 have high fluorescence yields (phi17 = 0.29; phi52 = 0.37) whereas Trp 152 (probably present in cucumber virus4) is strongly quenched (phi152 = 0.035). An unusually efficient Tyr leads to Trp energy transfer was observed in tobacco mosaic virus protein, indicating that most of four Tyr residues are located near the highly fluorescent Trp.
A strong increase in phenylalanine ammonia-lyase (EC 4.3.1.5) activity occurs in tobacco mosaic virus-infected tobacco leaves developing necrotic local lesions. Comparison of physicochemical properties of the partially purified enzymes extracted from healthy and infected leaves showed that the hypersensitive reaction leads to an increase in the pool size of the same active enzyme molecules as those present in non-infected material. The molecular mechanism of enzyme formation was investigated by radiolabelling with [3H]leucine and by density labelling with 2H2O. Abnormal patterns of incorporation of radioactivity into all soluble proteins were found in infected leaves carrying local lesions. In contrast, uptake of deuterium into the amino acid pool was the same in healthy and infected leaves. Unstimulated phenylalanine ammonia-lyase was shown to be a long-lived enzyme (half-life: 25-35 h). Results of comparative density labelling experiments unequivocally demonstrated that the increased enzyme pool size arose from an increased rate of synthesis mediated by the hypersensitive reaction.
Explore the source record for details and available documents.
Some of the fluorescence properties of brome mosaic virus protein in different states of aggregation (dimer, capsid) have been studied, in particular the emission spectra, fluorescence quantum yields and lifetimes, as well as the effect of external quenchers and of temperature on the fluorescence. Brome mosaic virus protein, which contains two tryptophan and five tyrosine residues per monomer, displayed an unusual fluorescence spectrum maximum of 308 nm at pH 7.4 when excited at 280 nm. The emission maximum was shifted to 327 nm when excited at 295 nm. Analysis of the results showed that the tyrosine emission is characterized by a high value for the quantum yield (phi = 0.07), which is consistent with a location of most of these residues in helical regions of the protein, while the tryptophan emission is strongly quenched (phi=0.035). The effects of external quenchers suggested that two kinds of tryptophan residues might exist, one buried (phi=0.056) and one exposed, the quantum yield of the latter being particularly low (phi=0.014). The tryptophan fluorescence quenching is partially removed at pH 8.4 and totally eliminated after chemical (guanidinium chloride) or thermal denaturation of the protein. Formation of capsid induced an additional quenching of the exposed tryptophan residue while interaction with the RNA in the virus did not modify the emission parameters of the protein.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.
The four alfalfa mosaic virus RNAs (respectively 24 S, 20 S, 17 S and 12 S) have been used separately as messengers in two in vitro protein synthesizing systems: wheat germ and rabbit reticulocyte lysate. In both systems a polypeptide corresponding to the translation of the entire length of the RNA can be found for RNAs 24 S, 20 S and 12 S, but not for 17 S RNA, the translation product of which is only 35,000 daltons. The number of initiation sites has been determined for each RNA by analyzing the initiation peptides synthesized in the presence of spasomycin and show that there is only one initiation or binding site perRNA. We thus conclude that each AMV RNA behaves as a monocistronic messenger in in vitro translating systems.
The experiments described in this paper and the following one establish the sequence of the 3'-OH terminal 159 nucleotides of turnip yellow mosaic virus RNA. Uniformly 32P-labeled turnip yellow mosaic virus RNA was partially digested with T1 ribonuclease and the fragments were fractionated by polyacrylamide gel electrophoresis. Fragments originating from the 3'-OH end of the RNA molecule were identified by testing for the 3'-terminal oligonucleotide, C-COH, after total U2 ribonuclease hydrolysis. Once identified, the 3'-OH terminal fragments were sequenced by the methods of Sanger et al. The first 51 nucleotides of the longest of the sequenced fragments (158 nucleotides) extends into the 3'-terminal part of the coat protein cistron. The coat protein cistron is followed by a stretch of 108 untranslated nucleotides whose function, though still unknown, is probably linked to the tRNA-like properties which have been attributed to the 3'-OH extremity of this viral RNA. Two possible secondary structures are proposed for the sequence and the implications of the findings with regard to the tRNA-like properties of the extremity are discussed.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
112 mother-child-father tercettes have been examined for several quantitative dermatoglyphic parameters (total ridge count--TRC--, radial and ulnar differrences, index of pattern type [KEITER]). The distribution of pattern among children has been compared to those of their parents. In the majority of cases within the empirical distribution of the children extreme values outside of the variation range of the parents were observed. This is in contrast to the formal genetic model of additive polygeny (HOLT). These findings have been interpreted as manifestation of TRC-heterogeneity suggesting a modifying action of radial and ulnar ridge differences. The parent-child correlation for the radio-ulnar differences and the index of pattern type were lower than that for the TRC. The interpretation of unexpected differences in quantitative dermatoglyphic parameters of children in relation to the variation of their parents has to be discussed very carefully. Due to the small number of material a correlation between the isolated position of the children in TRC to mother-child-differences in serological markers could not be excluded in this study.
320 adults and 100 family tercettes from the area of Hamburg were studied concerning the distribution and frequency of different lip patterns as well as special structures of lip ridges (whorls). Dividing the material in three phenotypic classes the phenotype corresponding to less wrinkle intensity was found to be most frequent. Simple branching ridges and complicated phenotypes were present in almost similar frequency. The complicated patterns as well as structural details were more frequent among males. In the family tercettes, the offsprings from parents with less branching patterns showed a wide range of variation. Dominant genetic factors could be suggested for the manifestation of paramedial double whorls on the lower lip. Embryological considerations as well as studies by Hirth et al. (1977) agree to these interpretations.
In 53 mostly old patients with Amotio retinae (37 femeles and 16 males) the type of constitution, meaning the placement in the variation grade from leptomorph to pyknomorph, was determined by biometrical methods (discrimination analysis). The calculated mean values of the group of patients were compared to the results of a leptomorph and a pyknomorph group as well as those of a control group. On a linear scale from lepto- to pyknomorph the patients could be placed between the controls and the pyknomorphs. The tendency toward pyknomorphy was statistically significant in the male patients only.
The relative importances of protein-protein and RNA-protein interactions in stabilizing the architecture of brome mosaic virus particles are discussed in the light of the following experimental evidence: (a) disassembly pathways of the virus particles, (b) reassembly of the virus and self-association capacity of the protein moiety, and (c) the role of divalent cations in virus stabilization, and their relevance to localization of the RNA in the virus particles. Evidence is given that the capsid of BMV is primarily stabilized by hydrophobic bonds at low pH, but not around and above neutrality where RNA-protein electrostatic interactions are essential to the integrity of the virus particles. A model is proposed for the structure of BMV in the different configurational states.