PubMed Health⌕ Search

Biomedical subjects

L J Blum

Publications and source records attributed to L J Blum.

At least 19 recordsLinked to original sources
PubMed2006

Dithiocarbamate fungicide thiram detection: comparison of bioluminescent and fluorescent whole-cell bioassays based on hsp22 stress promoter induction.

Detection of toxic substances interfering with endocrine system is one of the major preoccupations of the European community. A whole-cell bioassay for pollution detection based on stress induction has been designed. Well characterized toxicants, cadmium chloride and thiram (a dithiocarbamate fungicide), were used to optimize the detection conditions such as time-course conditions, cell line and reporter gene to be used. HeLa cells containing the firefly luciferase (luc) reporter gene under the control of the Drosophila melanogaster hsp22 promoter were compared to liver cells (HepG2) containing the same stress gene promoter fused either to the luc or the EGFP (Enhanced-Green Fluorescent Protein) gene. The sensitivity of the obtained bioassay was found to be enhanced by the concomitant use of liver cells and EGFP reporter gene. The detection limits of the toxicants were then lowered from 1 to 0.1 microM and from 1 to 0.01 microM for CdCl(2) and thiram, respectively.

Biological Assay↗
PubMed2006

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Base Sequence↗
PubMed2005

Chemical stress sensitive luminescent human cells: molecular biology approach using inducible Drosophila melanogaster hsp22 promoter.

A whole-cell bioassay has been developed for the total toxicity testing of liquid samples. The method is based on the induction of the bioluminescent activity of genetically manipulated mammalian cells. For that purpose, transfection was used to introduce, in HeLa cells, a DNA sensing element that responds to chemical stress agents (heavy metals, genotoxic agents, and endocrine-disrupting chemicals). Such element was designed to direct the expression of a reporting gene (firefly luciferase) through the activation of Drosophila melanogaster hsp22 promoter. A molecular approach was conducted to optimize hsp22 promoter element in order to decrease the background expression level of the reporting gene and to increase the sensitivity of the bioassay for testing endocrine disruptors. As a result, in the presence of 20-100 microM cadmium chloride, a 6-fold increase in luciferase expression was obtained using a specially designed truncated hsp22 promoter construction. The following chemicals known to be found in the polluted samples were tested: CdCl2, Cd(NO3)2, NaAsO2, alachlore, fentine acetate, thiram, and maneb. The stressing effect of each of them was sensitively detected by the present bioassay in the 0.05-50 microM concentration range.

Animals↗
PubMed2000

Chemiluminescent choline biosensor using histidine-modified peroxidase immobilised on metal-chelate substituted beads and choline oxidase immobilised on anion-exchanger beads co-entrapped in a photocrosslinkable polymer.

A novel sensing layer design is presented based on the non-covalent immobilisation of enzymes on derivatized Sepharose beads subsequently entrapped in PVA-SbQ photopolymer. Two different modified Sepharose beads were used, IDA- and DEAE-Sepharose, for the immobilisation, respectively, of horseradish peroxidase (HRP) modified with histidine, and choline oxidase (Chx). The HRP-IDA-Sepharose-based sensing layer was used in a flow injection analysis chemiluminescent system as the basis of an H2O2 biosensor. It was shown that the pre-immobilisation on IDA-Sepharose beads enhanced the sensing layer stability and enabled the immobilisation of a larger amount of enzyme. A 1.8 mg charge of HRP-IDA-Sepharose beads in the sensing layer produced the most sensitive H2O2 biosensor. Such an analytical system exhibited very good performances, with a cycle time of 2 min and a detection limit of 15 pmol (detection ranging over four decades at least), and an unusual long operational stability of 200 measurements (CV, 3.5%). The HRP-IDA-Sepharose beads were then combined with Chx-DEAE-Sepharose. With this modified Sepharose-based biosensor the limit of detection for choline (S/N, 3) was equal to 0.5 pmol and the working range was 0.35 pmol-10 nmol. Moreover, the cycle time was only 2.5 min with the new sensing layer, and a long operational stability of 150 successive assays was found, with a variation coefficient of 2.6%.

Alcohol Oxidoreductases↗
PubMed2000

An electrochemiluminescence-based fibre optic biosensor for choline flow injection analysis.

A fibre optic biosensor based on luminol electrochemiluminescence (ECL) integrated in a flow injection analysis (FIA) system was developed for the detection of choline. The electrochemiluminescence of luminol was generated by a glassy carbon electrode polarised at +425 mV vs. a platinum pseudo-reference electrode. Choline oxidase (Chx) was immobilised either covalently on polyamide (ABC type) or on UltraBind preactivated membranes, or by physical entrapment in a photo-cross-linkable poly(vinyl alcohol) polymer (PVA-SbQ) alone or after absorption on a weak anion exchanger, DEAE (diethylaminoethyl) Sepharose. The optimisation of the reaction conditions and physicochemical parameters influencing the FIA biosensor response demonstrated that the choline biosensor exhibited the best performances in a 30 mM veronal buffer containing 30 mM KCl and 1.5 mM MgCl2, at pH 9. The use of a 0.5 ml min-1 flow rate enabled the measurement of choline by the membrane-based ECL biosensors in 8 or 5 min, with ABC or UltraBind membranes, respectively, whereas the measurement required only 3 min with the DEAE-PVA system. For comparison, the detection of choline was performed with Chx immobilised using the four different supports. The best performances were obtained with the DEAE-PVA-Chx sensing layer, which allowed a detection limit of 10 pmol, whereas with the ABC, the UltraBind and the PVA systems, the detection limits were 300 pmol, 75 pmol and 220 pmol, respectively. The DEAE-based system also exhibited a good operational stability since 160 repeated measurements of 3 nmol of choline could be performed with an RSD of 4.5% whereas the stability under the best conditions was 45 assays with the other supports.

Biosensing Techniques↗
PubMed2000

Ultrasonic methodology coupled to ATP bioluminescence for the non-invasive detection of fouling in food processing equipment--validation and application to a dairy factory.

The use of an ultrasonic apparatus (40 kHz) for the non-destructive, rapid and reproducible removal of biofilm from standard materials (stainless steel and polypropylene) in a dairy factory was investigated. The application of ultrasound with the tested conditions (10 s and 40 kHz) was found not to be detrimental for standard ATP (concentration ranging between 5 x 10(-9) and 10(-5) mol 1(-1)) and for prokaryotic cells, including both rods and coccoid-shaped bacteria (Escherichia coli and Staphylococcus aureus). It allowed the use of the ATP bioluminescence measurement for quantifying the biofilm removal. The repeatability of industrial milk removal was determined on fouled stainless steel and polypropylene sheets. The variability of the results with the sonication method was constant, +/-24% (coefficient of variation) for both surfaces, and was variable with the swabbing method, +/-42% for the stainless steel sheet and +/-74% for the polypropylene sheet. The ultrasonic apparatus removed twice the amount of industrial milk biofilm compared with the swabbing method in the case of the polypropylene sheets. The apparatus was used to validate the industrial cleaning protocols of a milk factory.

Adenosine Triphosphate↗
PubMed2000

The development of an ultrasonic apparatus for the noninvasive and repeatable removal of fouling in food processing equipment.

A new ultrasonic apparatus operating at a frequency of 40 kHz was developed to dislodge biofilms from food processing equipment in order to assess the effectiveness of cleaning protocols. Sonication conditions to remove biofilms and quantification by ATP-bioluminescence are described. An industrial meat process was developed at the laboratory level to form a biofilm with industrial characteristics. Our results show that the biofilm removal by sonication during 10 s is reproducible and four times greater compared to the swabbing method (83% removal of fouling material against 20%). Unlike the swabbing method, this ultrasonic apparatus permitted the immediately demonstration of the inefficiency (within 1 min) of an industrial meat cleaning protocol. This apparatus is portable, easy to use and can be operated by unskilled users.

Biofilms↗
PubMed1993

Design of bioluminescence-based fiber optic sensors for flow-injection analysis.

A fiber optic sensor based on enzyme-catalyzed light-emitting reactions has been developed and integrated in a flow-injection analysis (FIA) system. The firefly luciferase, specific for ATP, and the bacterial oxidoreductase/luciferase system, specific for NADH, have been immobilized on preactivated polyamide membranes. ATP and NADH analysis could be performed in the range from 0.1 pmol to 3 nmol and from 0.5 pmol to 1 nmol, respectively. By co-immobilizing these two bioluminescence systems on the same membrane, a multi-function biosensor has been designed allowing the alternate determination of ATP or NADH with the same sensitivity as that obtained with the two different mono-functional biosensors. A partly self-contained biosensor has been also developed for the flow injection analysis of NADH. For this purpose, FMN (one of the substrates of the bacterial bienzymatic system) has been embedded in a synthetic matrix. Different supports have been tested for the non-covalent immobilization of this substrate and its release in the immediate vicinity of the bound enzymes. Using a photo-crosslinked poly(vinyl alcohol) support, 40 reliable assays (CV = 4.5%) could be performed without changing or reloading the matrix.

Adenosine Triphosphate↗
PubMed1989

Design of luminescence photobiosensors.

The potential of immobilized enzyme membranes in biosensors has been explored in our group for several years. Although part of our work has been mainly devoted to electrochemical transducers and oxidases for the design of enzyme electrodes, the demand for ultrasensitive and highly selective sensors led us to consider the use of luminescent enzyme systems associated to optical transduction. When considering the need for operational and reliable biosensors in biotechnology, immobilization and stability of the sensing element still remain, in most cases, an unavoidable problem. We recently proposed a very fast and reliable procedure for preparing enzymatic membranes from Pall (Biodyne Immunoaffinity membranes) supplied in a pre-activated form. Both the firefly and bacterial systems as well as peroxidase for the chemiluminescent determination of various analytes, could be bound to such a support. Based on this approach, a fibre-optic sensor with immobilized enzymes has been designed which permits bio- or chemiluminescent analysis of ATP, NADH or H2O2 respectively. With the NADH-based system, other analytes could be detected using coupled dehydrogenases. This device appears very promising and includes the convenience of both the luminescence sensitivity as well as the handling of the biosensor design.

Adenosine Triphosphate↗
PubMed1989

Fibre-optic sensor with co-immobilised bacterial bioluminescence enzymes.

A fibre-optic bioluminescent sensor for the microdetermination of NADH is described. Measurements can be performed in the linear range 1 x 10(-9) M-3 x 10(-6) M with a detection limit of 3 x 10(-10) M using the bacterial luciferase and NAD(P)H:FMN oxidoreductase co-immobilised on a preactivated polyamide membrane. The relative standard deviation was 4.8-5.5% at 4 x 10(-8) M NADH and the steady-state response time was 2 min. When stored at -20 degrees C with 20% glycerol, the activity of the bioactive membranes was higher than that measured prior to freezing and then remained stable for more than four months.

Bacterial Proteins↗
PubMed1989

Optically-based chemical and biochemical sensors for the detection of some drugs and biological compounds.

The development of new methods for determining at a very low level a large spectrum of substances affecting the behaviour of living organisms is still a challenging goal. For such a purpose, chemical sensors which can be defined as the intimate combination of a sensitive and specific layer with a transducer, are undoubtedly among the more promising devices. In this field, optical sensors are expanding rapidly, mainly based on absorption, fluorescence, chemi- and bioluminescence. Beside pH and gases, drugs (anticonvulsant, antitumour, anaesthetic...) and other compounds of biological interest can be determined with specifically designed optical sensors, for instance immunosensors. Special attention will be given to optical biosensors with emphasis on chemi- and bioluminescence-based devices which are highly selective and ultrasensitive. When co-immobilizing various auxiliary enzymes in the sensing layer, the potentialities of such devices can be greatly extended as demonstrated by promising results recently obtained in our group.

Biosensing Techniques↗
PubMed1987

Theoretical analysis of a translocation-like model with saturable kinetics.

A theoretical analysis of the initial rates of product appearance in both compartments of a specifically designed diffusion cell separated by an asymmetrical enzyme membrane is presented. Variable substrate concentrations and different substrate diffusional limitations were considered. Our analysis shows that, under specific conditions, not only a product accumulation occurs in the compartment opposite to that in which the reaction takes place, but that substrate saturable kinetics can be obtained. These product translocation-like kinetics appear similar to those observed with translocation processes reported for biological situations. For such phenomena, a key role of the diffusion layer surrounding a bioactive surface is proposed.

Biological Transport↗
PubMed1986

Vectorial product concentration obtained with a permeable immobilized enzyme membrane. A new approach to the analysis of biological transport systems.

The theoretical analysis of the distribution on both sides of a flat porous membrane of the product generated by an enzyme covalently bound only on to one side of the membrane separating two compartments of widely different volumes is presented. Contrary to what occurs with heterogeneous symmetric systems, the diffusional limitations at the enzyme level play a prominent role, not only on the apparent enzyme activity, but also on product flux-splitting. The mathematical model developed shows that it is possible to concentrate the reaction product in the compartment opposite to that where the reaction occurs. The influence of the parameters and of the physical characteristics of an asymmetrical system on product distribution is analysed. This theoretical analysis is in excellent agreement with experimental data obtained with glucose oxidase immobilized on a porous collagen membrane.

Biological Transport↗
PubMed1972

Traumatic lung.

Explore the source record for details and available documents.

Blast Injuries↗
PubMedDate not supplied

Fibre-optic biosensor based on luminescence and immobilized enzymes: microdetermination of sorbitol, ethanol and oxaloacetate.

We have investigated highly selective and ultrasensitive biosensors based on luminescent enzyme systems linked to optical transducers. A fibre-optic sensor with immobilized enzymes was designed; the solid-phase bioreagent was maintained in close contact contact with the tip of a glass fibre bundle connected to the photomultiplier tube of a luminometer. A bacterial luminescence fibre-optic sensor was used for the microdetermination of NADH. Various NAD(P)-dependent enzymes, sorbitol dehydrogenase, alcohol dehydrogenase and malate dehydrogenase, were co-immobilized on preactivated polyamide membranes with the bacterial system and used for the microdetermination of sorbitol, ethanol and oxaloacetate at the nanomolar level with a good precision.

Biosensing Techniques↗