PubMed Health⌕ Search

Biomedical subjects

L Jiang

Publications and source records attributed to L Jiang.

At least 19 recordsLinked to original sources

Fatal, virus-associated peripheral neuropathy and retinopathy in farmed Penaeus monodon in eastern Australia. I. Pathology.

Lesions are described in farmed Penaeus monodon affected with a previously unreported, fatal disease, 'peripheral neuropathy and retinopathy' (PNR). Outbreaks, associated with minor to heavy mortalities, occurred in 22 of 25 ponds on a farm in eastern Australia during the mid to late 1998/99 growout period. Moribund prawns, 5 to 26 g mean body weight, gathered at pond edges and were typically reddish in colour, lethargic, with mild to moderate epibiotic fouling and 1 or more partially amputated appendages. Histologically, there was mild to severe, focal to diffuse degeneration and necrosis of axons and their sheaths, together with associated glial cell apoptosis, in peripheral nerve fibres. Of the 3 appendage types examined systematically, these pathognomonic lesions were most common and severe in proximal antennal nerves and less common and severe in distal antennal nerves, antennular nerves and pereiopod nerves. Mild to severe, acute to chronic retinitis, associated with degeneration and necrosis of retinular cells and their axons, was also present in most clinically affected prawns. Transmission electron microscopy revealed moderate to large numbers of intracytoplasmic rod-shaped, helical nucleocapsids and enveloped virions, morphologically consistent with a yellow head-like virus, in putative glial cells in the antennal nerve, in the fasciculated zone of the eye and in putative sensory nerve cells of antennules. Immunohistochemical examination revealed lesions, but not histologically normal tissues, in peripheral nerves, eyes, lymphoid organ and vas deferens that consistently stained positively for a yellow head-related virus. The findings strongly suggest that a yellow head-related virus such as the Australian gill-associated virus (GAV) is causally associated with PNR. It is likely that PNR was not recognised during earlier investigations of mid-crop mortalities of farmed P. monodon in eastern Australia because appropriate peripheral nerves and eyes were not routinely examined histologically.

Animals↗

Fatal, virus-associated peripheral neuropathy and retinopathy in farmed Penaeus monodon in eastern Australia. II. Outbreak descriptions.

Outbreaks of 'peripheral neuropathy and retinopathy' (PNR) occurring during 2 consecutive growout periods (typically October-April) are described for an intensive Penaeus monodon farm in eastern Australia. In the 1998/99 growout period, outbreaks graded minor to severe occurred in 22 of 25 ponds, 12 to 25 wk post-stocking. In the severely affected index pond, harvested 8 wk after outbreak recognition in mid-January, estimated survival for the period late December to harvest was 50%. Minor to moderate losses could be attributed to PNR in the other ponds. Mean survival over the same period for the 14 ponds harvested within 5 wk of outbreak recognition was 93% (83 to 100%); for the 7 ponds harvested 5 to 8 wk after outbreak recognition was 79% (67 to 92%) and for the 3 unaffected ponds was 90% (86 to 95%). Analysis indicated a significantly lower risk (Fisher's exact p = 0.016) of an outbreak in the 2 ponds stocked only with postlarvae from one hatchery (D) versus the 18 ponds stocked only with postlarvae from 3 other hatcheries (A, B and C). In the 1999/2000 growout period, minor to severe PNR outbreaks occurred in all 26 ponds, each stocked with postlarvae from the same hatchery (E), 19 to 21 wk post-stocking. Stocking date in 1999/2000 appeared to influence PNR outbreak severity; for ponds stocked on 2 of the 7 stocking dates versus those stocked on remaining dates, the crude relative risks (CRR) of a severe outbreak, or either a moderate or severe outbreak, were 11.25 (1.55 < CRR < 81.40) and 2.63 (1.30 < CRR < 5.31), respectively. Although inconclusive, study findings are consistent with the hypothesis that 'gill-associated virus' (GAV), the putative causal pathogen identified in a separate pathological study, entered ponds via postlarvae, and that prevalence and/or severity of infection within postlarval batches influenced outbreak severity. The generally high survival in ponds harvested soon after outbreak recognition, together with PNR prevalence of approximately 50% in prawns collected from 4 ponds 7 wk before those ponds were recognised as affected, also suggest that GAV is highly infectious and that PNR has a relatively long incubation period and/or clinical course.

Animals↗

Proteomic analysis of the cerebrospinal fluid of patients with schizophrenia.

We applied proteomics technologies to analyze the cerebrospinal fluid of patients with schizophrenia. Such an analysis can result in the identification of proteins, which may play a role in the disease progress and thus lead to the discovery of clues of the etiology of schizophrenia. Cerebrospinal fluid from patients and controls was analyzed by two-dimensional gels and the proteins were identified by matrix-assisted laser desorption ionization mass spectrometry (MS) in the MS and MS/MS mode. 54 different gene products were identified, which were mainly plasma proteins. The level of apolipoprotein A-IV was significantly decreased in the schizophrenic patients compared to that in the controls. Little is known about the function of this apolipoprotein in the central nervous system. The levels of certain other proteins, like haptoglobin, fibrinogen, complement component 3, and Gc-globulin, were altered in the disease group as well, however, the changes did not reach a statistical significance.

Apolipoproteins A↗

Cardiomyocyte apoptosis is associated with increased wall stress in chronic failing left ventricle.

AIMS: We examined cardiomyocyte apoptosis in chronic heart failure (HF) and its possible link to elevated wall stress. METHODS AND RESULTS: Moderate HF was produced in sheep by sequential coronary microembolization. Six months later, the animals remained in a stable compensated haemodynamic state of HF. Apoptosis of cardiomyocytes in left ventricles was verified using Western blotting based on increased expression of: the apoptosis-associated death receptor Fas (1.5-fold); its ligand (FasL, 2.0-fold); and an upstream protease caspase-8 (2.7-fold) as well as its active cleavage peptide, p20 (5.6-fold). Previously we have reported the elevated expression of caspase-3 in the same animal model. The occurrence of apoptotic cardiomyocytes (0.3%) was quantified by TUNEL assays. Haemodynamic analysis indicated that ventricular dilatation, without wall thickening, caused a 2-fold increase in LV wall stress which, together with LV end-diastolic pressure, was linearly correlated with expression of Fas/FasL. Immunohistochemical studies localized FasL and caspase-8 to intercalated discs, suggesting that wall stress may play a role in initiating cardiomyocyte apoptosis. CONCLUSION: Apoptosis of cardiomyocytes in chronic HF is associated with increased wall stress, which may be responsible for the activation of a Fas/FasL and caspase-8 interaction in the region of intercalated discs.

Animals↗

Spine needle biopsy simulator using visual and force feedback.

OBJECTIVE: Biopsy with an inserted needle is an important procedure for lesion detection in the spine, but is difficult to perform due to the presence of many critical organs near the spine. This article presents a spine needle biopsy simulator, based on visual and force feedback, which can be used to plan the optimal path of a needle and to practice the procedure without risk. MATERIALS AND METHODS: The simulator is composed of a 3D human model, a visual-feedback component, a force-feedback component, and an evaluation module. The human model is based on 3D CT data. The visual-feedback component provides an oblique section, multiplanar reformatting images, and a volume-rendered image. Of these, the oblique section display is very useful for planning a 3D path for the needle. During simulation, the force-feedback component generates and provides realistic forces acting on the biopsy needle in real time by synchronizing them to visual feedback. After each simulation, the evaluation module provides a performance analysis for the trainee. RESULTS: For an XCT abdomen volume data set of 256 x 256 x 256, the update rate of image rendering due to needle movement is over 25 Hz, with a force-feedback rate of 1 kHz. This performance proved to be good enough for the trainee to learn the relationship between visual and force feedback. CONCLUSIONS: The simulator is useful for the planning of and training in complicated 3D spine needle biopsy procedures. It may be used as an educational tool for beginners, a practice tool to increase expertise, or a test bed for new procedures.

Algorithms↗

The protein storage vacuole: a unique compound organelle.

Storage proteins are deposited into protein storage vacuoles (PSVs) during plant seed development and maturation and stably accumulate to high levels; subsequently, during germination the storage proteins are rapidly degraded to provide nutrients for use by the embryo. Here, we show that a PSV has within it a membrane-bound compartment containing crystals of phytic acid and proteins that are characteristic of a lytic vacuole. This compound organization, a vacuole within a vacuole whereby storage functions are separated from lytic functions, has not been described previously for organelles within the secretory pathway of eukaryotic cells. The partitioning of storage and lytic functions within the same vacuole may reflect the need to keep the functions separate during seed development and maturation and yet provide a ready source of digestive enzymes to initiate degradative processes early in germination.

Aquaporins↗

Exploiting conformationally constrained peptidomimetics and an efficient human-compatible delivery system in synthetic vaccine design.

Peptide and protein mimetics are potentially of great value in synthetic vaccine design. The mimetics should function by stimulating the immune system to produce antibodies that recognize the intact parasite. Also the mimetics should be presented to the immune system in a way that leads to efficient antibody production. Here we investigate the application of cyclic peptidomimetics presented on immunopotentiating reconstituted influenza virosomes (IRIVs), a form of antigen delivery that is licensed already for human clinical use, in synthetic vaccine design. We focus on the central (NPNA)(n) repeat region of the circumsporozoite (CS) protein of the malaria parasite Plasmodium falciparum as a model system. Cyclic peptidomimetics of the NPNA repeats were incorporated into both an IRIV and (for comparison) a multiple-antigen peptide (MAP). Both IRIV and MAP delivery forms induced mimetic-specific humoral immune responses in mice, but only with the mimetic-IRIV preparations did a significant fraction of the elicited antibodies cross-react with sporozoites. The results demonstrate that IRIVs are a delivery system suitable for the efficient induction of antibody responses against conformational epitopes by use of cyclic template-bound peptidomimetics. Combined with combinatorial chemistry, this approach may have great potential for the rapid optimization of molecularly defined synthetic vaccine candidates against a wide variety of infectious agents.

Animals↗

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

Adenine↗

Self-assembled monolayers of new dendron-thiols: manipulation of the patterned surface and wetting properties.

SAMs based on a novel dendron-thiol system, which maintain the alkanethiols' active site, but with the -SH group connected to independently variable groups by a dendron-linker, showed a controllable surface pattern and wetting properties. The precisely tailored structure of dendron-thiols with locally controlled hydrophobic and hydrophilic peripheries allows the formation of designed surface structures on a gold surface, e.g. nano-stripes, honeycomb and homogeneous structures.

Journal Article↗

Proton exchange and base pair opening in a DNA triple helix.

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.

Base Pairing↗

Expression of GnTIII in a recombinant anti-CD20 CHO production cell line: Expression of antibodies with altered glycoforms leads to an increase in ADCC through higher affinity for FC gamma RIII.

The gene encoding the rat glycosylation enzyme beta1-4-N-acetylglucosaminyltransferase III (GnTIII) was cloned and coexpressed in a recombinant production Chinese hamster ovary (CHO) cell line expressing a chimeric mouse/human anti-CD20 IgG1 antibody. The new cell lines expressed high levels of antibody and have growth kinetics similar to that of the parent. Relative QPCR showed the cell lines to express varying levels of mRNA. High-performance liquid chromatography (HPLC) analysis showed the enzyme to have added bisecting N-acetylglucosamine (GlcNAc) residues in most (48% to 71%) of the N-linked oligosaccharides isolated from antibody preparations purified from the cell lines. In an ADCC assay the new antibody preparations promoted killing of CD20-positive target cells at approximately 10- to 20-fold lower concentrations than the parent. This activity was blocked using an anti-Fc gamma RIII antibody, supporting the role of Fc gamma RIII binding in this increase. In addition, cell binding assays showed the modified antibody bound better to Fc gamma RIII-expressing cells. The increase in ADCC activity is therefore likely due to an increased affinity of the modified antibody for the Fc gamma RIII receptor.

Animals↗

Image-guided robotic delivery system for precise placement of therapeutic agents.

The effectiveness of conventional solid tumor treatment is limited by the systemic toxicity and lack of specificity of chemotherapeutic agents. Present treatment modalities are frequently insufficient to eliminate competent cancer cells without exceeding the limits of toxicity to normal tissue. The coming generation of cancer therapeutics depends on the precise targeting and sustained release of antitumor agents to overcome these limitations. We are developing an image-guided, robotic system for precise intratumoral placement of anticancer drugs and sustained release devices to advance this new treatment paradigm. The robotic system will use intraoperatively obtained computed tomographic (CT) images from a mobile CT scanner for guidance. The concept is to track patient anatomy and localize instruments using currently available optical tracking technology. Tracking will also be used to register patient anatomy with the images. The physician can then use the registered image to select an appropriate tumor target and entry location and to plan the instrument path. This path will then be transmitted to the robot, which orients and drives the instrument to the desired target under physician control. Achievement of the target is confirmed via intraoperative CT. This system will provide instrument guidance that is precise, direct, and controllable. Error due to poor target visualization and hand unsteadiness should be reduced greatly. The basic components of the system (robot, mobile CT, tracking) have been demonstrated in our laboratory, and the integration of the components is in progress. In future work, we plan to fuse preoperative PET imaging with intraoperative CT to allow functional as well as anatomic image guidance.

Antineoplastic Agents↗

Mass-transfer limitations for immobilized enzyme-catalyzed kinetic resolution of racemate in a fixed-bed reactor.

A mathematical model has been developed for immobilized enzyme-catalyzed kinetic resolution of racemate in a fixed-bed reactor in which the enzyme-catalyzed reaction (the irreversible uni-uni competitive Michaelis-Menten kinetics is chosen as an example) was coupled with intraparticle diffusion, external mass transfer, and axial dispersion. The effects of mass-transfer limitations, competitive inhibition of substrates, deactivation on the enzyme effective enantioselectivity, and the optical purity and yield of the desired product are examined quantitatively over a wide range of parameters using the orthogonal collocation method. For a first-order reaction, an analytical solution is derived from the mathematical model for slab-, cylindrical-, and spherical-enzyme supports. Based on the analytical solution for the steady-state resolution process, a new concise formulation is presented to predict quantitatively the mass-transfer limitations on enzyme effective enantioselectivity and optical purity and yield of the desired product for a continuous steady-state kinetic resolution process in a fixed-bed reactor.

Bioreactors↗

Transient expression of somatostatin mRNA in developing ganglion cell layers of rat retina.

Somatostatin (SOM) mRNA in developing ganglion cell layer (GCL) detected by in situ hybridization histochemistry and SOM peptide in developing optic chiasma and optic tract detected by immunocytochemistry were monitored to explore whether ganglion cells expressing SOM project to the visual center. Most of these cells in the developing GCL expressed SOM transiently from embryonic day 13 (E13) to E21. The cells expressing SOM mRNA initially followed a central-to-peripheral pattern of development. The cells expressing SOM mRNA in the retinas of fetuses became detectable at E13. From E14 to E17 the number of cells expressing SOM mRNA increased rapidly. At E17 most of the cells in the developing GCL expressed SOM mRNA. From E18 to postnatal days the positive cells became sparse except at the postnatal day 0 (PND0) the positive cells decreased dramatically in comparison with that at the E21. At PND15, the positive cells only can be found in the inner neuroblastic layer and in the ganglion cell layer. At PND20 the distribution pattern and the number of the positive cells were essentially the same as that in adult rat. SOM immunoreactivity was detectable at E16 in the developing optic chiasma and optic tract; the majority of the fibers in these area were SOM positive. From E16 to E18 the density of the immunostaining increased rapidly, whereas from E19 to E21 the density decreased. At PND0 no positive fibers were seen. The transient presence of SOM in most of the ganglion cells in the developing ganglion cell layer has prompted us to study the role of SOM in generation and differentiation of the retinal ganglion cells, and formation of the retina-visual center projections.

Aging↗

Temperature-induced decoupling of phycobilisomes from reaction centers.

Temperature-induced decoupling of phycobilisomes (PBSs) from the reaction centers in the PBS-thylakoid membrane complexes was observed at 0 degrees C. The fluorescence yields of photosystem (PS) I and PSII decreased and that of PBSs increased with selective excitation of PBSs at 0 degrees C, while the yield of PBSs decreased and those of the two photosystems increased with selective excitation of chlorophyll a at room temperature (RT). It indicated that the decoupling of PBSs from the two photosystems led to changes of energy transfer efficiencies, which can be explained by partial detachment of PBSs from thylakoid membrane. The temperature-dependent processes were reversible, i.e. with temperature going up to RT, the complexes could restore to the functionally coupled state with a time constant about 30 s. Based on these results, it could be deduced that PBSs should be in parallel connection with the two photosystems.

Betaine↗