Biomedical subjects

L Kittler

Publications and source records attributed to L Kittler.

40 records · Page 3Linked to original sources

PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗

PubMedDate not supplied

Quantitative and sequence-specific analysis of DNA-ligand interaction by means of fluorescent intercalator probes.

A novel method of analysis of double-stranded DNA-ligand interaction is presented. The interaction is monitored by the fluorescence of a DNA bis-intercalator oxazole homodimer YoYo-3. The fluorescence intensity or its decay time reflects the modification of the DNA double helix. The DNA sequence is scanned by hybridization with short oligomers having consecutively overlapping complementary sequences to analyse the sequence specificity of binding. In our experiments we used as ligands the minor groove binders netropsin, SN6999 (both with AT-preference), the GC-specific ligand chromomycin A3 as well as the derivative SN6113 (non-specific interaction), which displace the bis-intercalator YoYo-3 or influence the duplex structure in such away that the fluorescence intensity and lifetime decrease in comparison to a ligand-free screening. The changes of fluorescence emission clearly define the binding motif and indicate minor groove interactions with a reduced DNA binding site. Titration of the ligand quantitatively characterizes its binding by determining the dependence of the binding constant on the oligonucleotide sequence.

Binding Sites↗

PubMedDate not supplied

Sequence specific modulation of DNA restriction enzyme cleavage by minor groove binders.

The inhibition of restriction endonuclease cleavage by a series of bisquaternary ammonium derivatives (BQA-derivatives) which bind to the minor groove of DNA has been studied. The derivatives considered included six sequence-selective binders (SN 6570, SN 6999, SN 6050, SN 6132, SN 6131 and SN 18071) and four non-specific binders (SN 6113, SN 5754, SN 6324 and SN 4094) and can be distinguished by their activity on restriction endonucleases. Digestion experiments with pUC19 DNA were monitored electrophoretically using the transition of the covalently closed circular (ccc) DNA into the linear double stranded (lds) one. Only the sequence-specific binders inhibit the cleavage activity of restriction endonucleases EcoRI, SspI and DraI with four and six dAdT-base pairs within their restriction sites, while the activity of SalI and BamHI with less than four dAdT-sequences was unaffected. In contrast, the non-specific binding ligands were incapable of suppressing enzyme digestion. The inhibition of the restriction endonuclease PvuII indicates that ligand binding in close vicinity to the cleavage sites is also involved in the enzyme inhibition. The dAdT-content in proximity to the palindromic sequences of three DraI cutting sites in pUC19 DNA explains why the derivative SN 6053 protects these sequences in different manners. Gel shift experiments indicated that BQA-derivatives inhibit the DNA-enzyme complex formation if the ligand was added to the DNA before the enzyme. In contrast, complex formation between DNA and enzyme remained unchanged when the enzyme was added first.

Deoxyribonucleases, Type II Site-Specific↗

PubMedDate not supplied

Specific targeting of human papillomavirus type 16 E7 oncogene with triple-helix forming purine oligodeoxyribonucleotides.

Molecular mechanical calculations (computer modelling), optical DNA melting experiments and co-migration assay were used to assess stable helix formation at homopurine--homopyrimidine-rich target sites present in the human papillomavirus type 16 E7 oncogene (positions 656-673 on the genome map). The target sequence, either present in the E7 oncogene obtained by PCR technique or prepared from oligodeoxyribonucleotides (ODNs), can be specifically recognised by different 17-merpurine ODNs designed to form antiparallel or parallel triple helices. These in vitro experiments realised with rather long purine ODNs having a high degree of specificity open the way for in vivo tests focused on E7 oncogene targeting and suppression.

Base Sequence↗