Human rights, constructive accountability and maternal mortality in the Dominican Republic: a commentary.
Explore the source record for details and available documents.
Delivery, Obstetric↗
Biomedical subjects
L P Freedman
Publications and source records attributed to L P Freedman.
The acute promyelocytic leukemia-associated protein, promyelocytic leukemia zinc finger, regulates 1,25-dihydroxyvitamin D(3)-induced monocytic differentiation of U937 cells through a physical interaction with vitamin D(3) receptor.
Monocyte differentiation induced by 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) is interrupted during the course of acute promyelocytic leukemia (APL). One form of APL is associated with the translocation t(11;17), which joins the promyelocytic leukemia zinc finger (PLZF) and retinoic acid receptor alpha (RARalpha) genes. Because PLZF is coexpressed in the myeloid lineage with the vitamin D(3) receptor (VDR), the interplay between PLZF and VDR was examined. It was found that PLZF interacts directly with VDR. This occurred at least partly through contacts in the DNA-binding domain of VDR and the broad complex, tram-trak, bric-a-brac/pox virus zinc finger (BTB/POZ) domain of PLZF. Moreover, PLZF altered the mobility of VDR derived from nuclear extracts when bound to its cognate binding site, forming a slowly migrating DNA-protein complex. Overexpression of PLZF in a monocytic cell line abrogated 1,25(OH)(2)D(3) activation from both a minimal VDR responsive reporter and the promoter of p21(WAF1/CIP1), a target gene of VDR. Deletion of the BTB/POZ domain significantly relieved PLZF-mediated repression of 1,25(OH)(2)D(3)-dependent activation. In addition, stable, inducible expression of PLZF in U937 cells inhibited the ability of 1,25(OH)(2)D(3) to induce surface expression of the monocytic marker CD14 and morphologic changes associated with differentiation. These results suggest that PLZF may play an important role in regulating the process by which 1,25(OH)(2)D(3) induces monocytic differentiation in hematopoietic cells.
Binding Sites↗
Repression of transcription of the p27(Kip1) cyclin-dependent kinase inhibitor gene by c-Myc.
Upon engagement of the B Cell Receptor (BCR) of WEHI 231 immature B cells, a drop in c-Myc expression is followed by activation of the cyclin-dependent kinase inhibitor (CKI) p27(Kip1), which induces growth arrest and apoptosis. Here, we report inverse patterns of p27 and c-Myc protein expression follow BCR engagement. We present evidence demonstrating, for the first time, that the p27(Kip1) gene is a target of transcriptional repression by c-Myc. Specifically, the changes in p27 protein levels correlated with changes in p27 mRNA levels, and gene transcription. Induction of p27 promoter activity followed BCR engagement of WEHI 231 cells, and this induction could be repressed upon co-transfection of a c-Myc expression vector. Inhibition of the TATA-less p27 promoter by c-Myc was also observed in Jurkat T cells, vascular smooth muscle, and Hs578T breast cancer cells, extending the observation beyond immune cells. Consistent with a putative Inr element CCAGACC (where +1 is underlined) at the start site of transcription in the p27 promoter, deletion of Myc homology box II reduced the extent of repression. Furthermore, enhanced repression was observed upon transfection of the c-Myc 'super-repressor', with mutation of Phe115 to Leu. The sequences mediating transcriptional activity and c-Myc repression were mapped to bp -20 to +20 of the p27 gene. Finally, binding of Max was shown to facilitate c-Myc binding and repression of p27 promoter activity. Overall, these studies identify the p27 CKI gene as a new target whereby c-Myc can control cell proliferation, survival and neoplastic transformation.
Animals↗
Molecular analysis of the prostate-specific antigen upstream gene enhancer.
BACKGROUND: Our objective was to identify factors other than androgen receptor that bind to and regulate the prostate-specific antigen (PSA) upstream gene enhancer (PSE). METHODS: DNAse I footprinting and electromobility shift assays (EMSA) were performed over the PSE using lysates from PSA-producing cell lines, LNCaP and LAPC4, and nonproducing PSA cell lines, PC-3 cells, U937 monocytes, and Namalwa B cells. Mutational analysis and transient transfection assays were used to determine the contributions made by different elements towards the regulation of the enhancer. RESULTS: Three distinct regions surrounding androgen response elements of the PSE were found to bind unknown ubiquitous and cell type-specific proteins. These regions, when mutated in a PSE reporter construct, were shown to be required for maximal activation in LNCaP cells. CONCLUSIONS: These results correlate unknown sequence-specific DNA binding proteins with androgen-mediated regulation of a prostate-specific gene, thus providing further insight into the mechanism of PSA gene expression.
Base Sequence↗
Using human rights in maternal mortality programs: from analysis to strategy.
This article describes an approach to maternal mortality reduction that uses human rights not simply to denounce the injustice of death in pregnancy and childbirth, but also to guide the design and implementation of maternal mortality policies and programs. As a first principle, programs and policies need to prioritize measures that promote universal access to high quality emergency obstetric care services, which we know from health research are essential to saving women's lives. With that priority, human rights principles can be integrated into programs at the clinical, facility management, and national policy levels. For example, a human rights 'audit' can help identify ways to encourage respectful, non-discriminatory treatment of patients, providers and staff in the clinical setting. Human rights principles of entitlement and accountability can inform mechanisms of community participation designed to improve responsiveness and functioning of health facilities. Human rights principles can inform analysis of health sector reform and its impact on access to emergency obstetric care. Whether applied to the intricacies of human relationships within a facility or to the impact of international financial institutions on health systems, the ultimate role of human rights is to identify the workings of power that keep unacceptable levels of maternal morality as they are and to use the human rights vision of dignity and social justice to work for the re-arrangements of power necessary for change.
Emergency Medical Services↗
Mediator complexes and transcription.
Over the past decade, various components of the transcription machinery have been identified as potential targets for activators. Recently, metazoan versions of yeast Mediator have been isolated and found to act as key coactivators to many transcription factors. Recent work has defined the composition, function and biology of metazoan mediator complexes, which has led us to propose a new nomenclature for the variously named versions of the mediator complex.
Animals↗
Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
Androgens↗
p21 is a transcriptional target of HOXA10 in differentiating myelomonocytic cells.
The myeolomonocytic cell line U937 differentiates into macrophages in response to a variety of agents. Several genes including the cyclin-dependent kinase inhibitor p21(waf1/cip1) and the homeobox gene transcription factor HOXA10 are induced at the onset of differentiation. Ectopic expression of either gene results in U937 differentiation. In this paper, we describe a mechanism by which p21 and HOXA10 may act in concert, where HOXA10 can bind directly to the p21 promoter and, together with its trimeric partners PBX1 and MEIS1, activate p21 transcription, resulting in cell cycle arrest and differentiation. These experiments for the first time identify p21 as a selective target for a HOX protein and link the differentiative properties of a transcription factor and a cell cycle inhibitor.
Cell Differentiation↗
Ligand-inducible interaction of the DRIP/TRAP coactivator complex with retinoid receptors in retinoic acid-sensitive and -resistant acute promyelocytic leukemia cells.
Retinoic acid (RA) signaling is mediated by its nuclear receptors RXR and RAR, which bind to their cognate response elements as a heterodimer, RXR/RAR, and act in concert with coregulatory factors to regulate gene transcription on ligand binding. To identify specific cofactors that interact with the RXR/RAR heterodimer in acute promyelocytic leukemia (APL) cells, a double cistronic construct was used that allowed coexpression of the RXR LBD (ligand binding domain) with the RAR LBD as an affinity matrix to pull down interacting proteins from nuclear extracts prepared from a human APL cell line, NB4. A group of proteins was detected whose interaction with RXR/RAR is ligand inducible. The molecular weight pattern of these proteins is similar to that of a complex of proteins previously identified as DRIP or TRAP, which are ligand-dependent transcription activators of VDR and TR, respectively. The RXR/RAR-interacting proteins from NB4 were confirmed to be identical to the DRIP subunits by comparative electrophoresis, Western blot analysis, and in vitro protein interaction assay. In addition to RXR/RAR, the DRIP component can interact directly with the APL-specific PML-RARalpha fusion protein. The same DRIP complex is present in RA-resistant APL cells and in a variety of cancer cell lines, supporting its global role in transcriptional regulation.
Antineoplastic Agents↗
Functional interactions between the estrogen receptor and DRIP205, a subunit of the heteromeric DRIP coactivator complex.
Nuclear receptors regulate transcription in direct response to their cognate hormonal ligands. Ligand binding leads to the dissociation of corepressors and the recruitment of coactivators. Many of these factors, acting in large complexes, have emerged as potential chromatin remodelers through intrinsic histone modifying activities. In addition, other ligand-recruited complexes appear to act more directly on the transcriptional apparatus. The DRIP complex is a 15-subunit complex required for nuclear receptor transcriptional activation in vitro. It is recruited to the receptor in response to ligand through specific interactions of one subunit, DRIP205. We present evidence that DRIP205 interacts with another member of the steroid receptor subfamily, estrogen receptor (ER). This interaction occurs in an agonist-stimulated fashion which in turn is inhibited by several ER antagonists. In vivo, a fragment of DRIP205 containing only its receptor interacting region acts to selectively inhibit ER's ability to activate transcription in response to estradiol. These observations suggest a key role for the DRIP coactivator complex in estrogen-ER signaling.
Animals↗
Binding of liganded vitamin D receptor to the vitamin D receptor interacting protein coactivator complex induces interaction with RNA polymerase II holoenzyme.
Because the vitamin D receptor interacting protein (DRIP) coactivator complex shares components with the RNA polymerase II (Pol II) holoenzyme complex, we tested whether the two protein complexes associate in cellular extracts. On initial purification steps, the DRIP complex copurified with the Pol II holoenzyme. Pol II was found to bind to the vitamin D receptor in a ligand-dependent fashion when either nuclear extracts or partially purified preparations were used as sources of DRIP and Pol II holoenzyme. A subpopulation of holoenzyme complexes bound to the receptor because BRCA1, which associates with the Pol II holoenzyme, did not associate with the liganded receptor, and only in certain of the holoenzyme- and DRIP-containing fractions did Pol II bind to the liganded receptor. Immunoprecipitation experiments revealed that the DRIP complex was not pre-associated with the Pol II holoenzyme, but the interaction between these two complexes was induced only in the presence of receptor and ligand. These data support a model in which the activation of transcription by hormone-bound receptor requires binding to the DRIP coactivator, and this induced ternary complex can then bind to the Pol II holoenzyme to activate transcription.
HeLa Cells↗
Mechanisms of gene regulation by vitamin D(3) receptor: a network of coactivator interactions.
The vitamin D(3) receptor regulates transcription in direct response to its cognate hormonal ligand, 1,25(OH)(2)D(3). Ligand binding leads to the recruitment of coactivators. Many of these factors, acting in large complexes, have emerged as chromatin remodelers partly through intrinsic histone modifying activities. In addition, other ligand-recruited complexes appear to act more directly on the transcriptional apparatus, suggesting that transcriptional regulation by VDR and other nuclear receptors may involve a process of both chromatin alterations and direct recruitment of key initiation components at regulated promoters.
Animals↗
Discrete roles for peroxisome proliferator-activated receptor gamma and retinoid X receptor in recruiting nuclear receptor coactivators.
Peroxisome proliferator-activated receptor gamma (PPARgamma) plays a major role in adipogenesis. PPARgamma binds to DNA as a heterodimer with retinoid X receptor (RXR), and PPARgamma-RXR can be activated by ligands specific for either receptor; the presence of both ligands can result in a cooperative effect on the transactivation of target genes. How these ligands mediate transactivation, however, remains unclear. PPARgamma is known to interact with both the p160/SRC-1 family of coactivators and the distinct, multisubunit coactivator complex called DRIP. A single DRIP subunit, DRIP205 (TRAP220, PBP), binds directly to PPARgamma. Here we report that PPARgamma and RXR selectively interacted with DRIP205 and p160 proteins in a ligand-dependent manner. At physiological concentrations, RXR-specific ligands only induced p160 binding to RXR, and PPARgamma-specific ligands exclusively recruited DRIP205 but not p160 coactivators to PPARgamma. This selectivity was not observed in interaction assays off DNA, implying that the specificity of coactivator binding in response to ligand is strongly influenced by the allosteric effects of DNA-bound heterodimers. These coactivator-selective effects were also observed in transient-transfection assays in the presence of overexpressed p160 or DRIP coactivators. The results suggest that the cooperative effects of PPARgamma- and RXR-specific ligands may occur at the level of selective coactivator recruitment.
3T3 Cells↗
The DRIP complex and SRC-1/p160 coactivators share similar nuclear receptor binding determinants but constitute functionally distinct complexes.
Transcriptional activation requires both access to DNA assembled as chromatin and functional contact with components of the basal transcription machinery. Using the hormone-bound vitamin D(3) receptor (VDR) ligand binding domain (LBD) as an affinity matrix, we previously identified a novel multisubunit coactivator complex, DRIP (VDR-interacting proteins), required for transcriptional activation by nuclear receptors and several other transcription factors. In this report, we characterize the nuclear receptor binding features of DRIP205, a key subunit of the DRIP complex, that interacts directly with VDR and thyroid hormone receptor in response to ligand and anchors the other DRIP subunits to the nuclear receptor LBD. In common with other nuclear receptor coactivators, DRIP205 interaction occurs through one of two LXXLL motifs and requires the receptor's AF-2 subdomain. Although the second motif of DRIP205 is required only for VDR binding in vitro, both motifs are used in the context of an retinoid X receptor-VDR heterodimer on DNA and in transactivation in vivo. We demonstrate that both endogenous p160 coactivators and DRIP complexes bind to the VDR LBD from nuclear extracts through similar sequence requirements, but they do so as distinct complexes. Moreover, in contrast to the p160 family of coactivators, the DRIP complex is devoid of any histone acetyltransferase activity. The results demonstrate that different coactivator complexes with distinct functions bind to the same transactivation region of nuclear receptors, suggesting that they are both required for transcription activation by nuclear receptors.
Amino Acid Sequence↗
Differential regulation of glucocorticoid receptor transcriptional activation via AF-1-associated proteins.
The hormone-activated glucocorticoid receptor (GR), through its N- and C-terminal transcriptional activation functions AF-1 and AF-2, controls the transcription of target genes presumably through interaction(s) with transcriptional regulatory factors. Utilizing a modified yeast two-hybrid approach, we have identified the tumor susceptibility gene 101 (TSG101) and the vitamin D receptor-interacting protein 150 (DRIP150) as proteins that interact specifically with a functional GR AF-1 surface. In yeast and mammalian cells, TSG101 represses whereas DRIP150 enhances GR AF-1-mediated transactivation. Thus, GR AF-1 is capable of recruiting both positive and negative regulatory factors that differentially regulate GR transcriptional enhancement. In addition, we show that another member of the DRIP complex, DRIP205, interacts with the GR ligand binding domain in a hormone-dependent manner and facilitates GR transactivation in concert with DRIP150. These results suggest that DRIP150 and DRIP205 functionally link GR AF-1 and AF-2, and represent important mediators of GR transcriptional enhancement.
Animals↗
20-Epi analogues of 1,25-dihydroxyvitamin D3 are highly potent inducers of DRIP coactivator complex binding to the vitamin D3 receptor.
1,25-Dihydroxyvitamin D3 (1,25(OH)2D3) plays a major role in the stimulation of bone growth, mineralization, and intestinal calcium and phosphate absorption; it also acts as a general inhibitor of cellular proliferation. Several new, clinically relevant compounds dissociate antiproliferative and calcemic activities of 1,25(OH)2D3, but the molecular basis for this has not been clearly elucidated. Here, we tested whether the potency of one class of compounds, 20-epi analogues, to induce myeloid cell differentiation, is because of direct molecular effects on vitamin D receptor (VDR). We report that two 20-epi analogues, MC1627 and MC1288, induced differentiation and transcription of p21(Waf1,Cip1), a key VDR target gene involved in growth inhibition, at a concentration 100-fold lower than that of 1,25(OH)2D3. We compared this sensitivity to analogue effects on VDR interacting proteins: RXR, GRIP-1, and DRIP205, a subunit of the DRIP coactivator complex. Compared with the interaction of VDR with RXR or GRIP-1, the differentiation dose-response most closely correlated to the ligand-dependent recruitment of the DRIP coactivator complex to VDR and to the ability of the receptor to activate transcription in a cell-free system. These results provide compelling links between the efficiency of the 20-epi analogue in inducing VDR/DRIP interactions, transactivation in vitro, and its enhanced ability to induce cellular differentiation.
Calcitriol↗
Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex.
Nuclear receptors modulate the transcription of genes in direct response to small lipophilic ligands. Binding to ligands induces conformational changes in the nuclear receptors that enable the receptors to interact with several types of cofactor that are critical for transcription activation (transactivation). We previously described a distinct set of ligand-dependent proteins called DRIPs, which interact with the vitamin D receptor (VDR); together, these proteins constitute a new cofactor complex. DRIPs bind to several nuclear receptors and mediate ligand-dependent enhancement of transcription by VDR and the thyroid-hormone receptor in cell-free transcription assays. Here we report the identities of thirteen DRIPs that constitute this complex, and show that the complex has a central function in hormone-dependent transactivation by VDR on chromatin templates. The DRIPs are almost indistinguishable from components of another new cofactor complex called ARC, which is recruited by other types of transcription activators to mediate transactivation on chromatin-assembled templates. Several DRIP/ARC subunits are also components of other potentially related cofactors, such as CRSP, NAT, SMCC and the mouse Mediator, indicating that unique classes of activators may share common sets or subsets of cofactors. The role of nuclear-receptor ligands may, in part, be to recruit such a cofactor complex to the receptor and, in doing so, to enhance transcription of target genes.
Amino Acid Sequence↗
Induced differentiation of U937 cells by 1,25-dihydroxyvitamin D3 involves cell cycle arrest in G1 that is preceded by a transient proliferative burst and an increase in cyclin expression.
The hormonal form of vitamin D, 1,25-dihydroxyvitamin D3 [1, 25(OH)2D3], is a potent inhibitor of cellular proliferation as well as an inducer of differentiation of myeloid leukemic cells to macrophages. We have previously reported that a number of genes are upregulated by 1,25(OH)2D3 during myeloid differentiation, including the cyclin-dependent kinase (CDK) inhibitors p21, p27, 15, and p18, suggesting that cell cycle arrest and differentiation are tightly linked processes. We further explore here the relationship between growth inhibition and differentiation. We report that, upon 1, 25(OH)2D3 treatment, U937 cells exhibited an early proliferative burst followed by growth inhibition and subsequent differentiation. Although CDK levels remain constant throughout, this transient increase in proliferation was accompanied by increases in cyclin A, D1, and E protein levels. p21 and p27 levels were also elevated during both the proliferative burst and subsequent inhibition of cell growth. Ectopic overexpression of p21 and/or p27 in U937 cells, in the absence of hormone, resulted in an induction of the expression of monocyte/macrophage-specific markers, whereas overexpression of p15 and p18 had no effect, suggesting that a subset of CDK inhibitors are important for both growth arrest and differentiation and that an early increase in proliferation is somehow a prerequisite for subsequent differentiation. However, no such biphasic behavior was detected in cells that are growth inhibited by 1,25(OH)2D3 but do not differentiate, such as MCF-7 cells. Taken together, these results indicate that both growth stimulation and subsequent inhibition precede differentiation and involve induction of both cyclins and p21 and p27, whereas cell cycle arrest of differentiated cells can be achieved simply by elevations in CDK inhibitors.
Calcitriol↗