PubMed Health⌕ Search

Biomedical subjects

L S Kan

Publications and source records attributed to L S Kan.

At least 19 recordsLinked to original sources

Formation of DNA triple helix containing N(4)-(6-aminopyridin-2-yl)-2'-deoxycytidine.

A cytidinyl derivative, N(4)-(6-aminopyridin-2-yl)- 2'-deoxycytidine ((p)C), could interact with a CG base pair to support the triple-helix (triplex) formation of oligodeoxyribonucleotides. Characteristics of (p)C in the formation of both intramolecular triplex, i.e., a "paper clip type" triplex ((P)CT) and intermolecular triplex, i.e., a "linear type" triplex (LT) was monitored by optical methods and isothermal titration calorimetric measurements. Experimental results revealed that the LT with (p)C*CG internally was independent of the solution pH. Only single substitution of (p)C, situated internally but not terminally, facilitated the (P)CT formation by the UV thermal melting study at the neutral pH. However, the best stabilization of the PCT in acidic conditions occurred when (p)C at the end of the triplex rather than internally. In addition, an LT, but not a (P)CT, containing an alternating (p)CT(p)CT(p)C sequence, could be formed in the conditions of 20 mM MgCl(2) and/or 5 mM spermine. Thus, the presence of several nucleotides of (p)C in proximity along the Hoogsteen strand may lead to structural distortion such that the more flexible LT with multiple substitutions is formed in favor of the more rigid PCT.

Aminopyridines↗

Interaction between 3-(p-tolylamino)-1,5-azulenequinone and the deoxyguanosine residue in various oligonucleotides upon photolysis.

Eight single-stranded oligodeoxyribonucleotides 32P-labeled at the 5'-end were synthesized; they were annealed with the complementary oligodeoxyribonucleotides to form the corresponding double-stranded helices. These duplexes possessed standard Watson-Crick base pairs, locally perturbed sites of a base mismatch, or a bulge. Further, 5'-32P-labeled oligodeoxyribonucleotides with a hairpin loop were also synthesized. Cleavage of these single- and double-stranded oligodexyribonucleotides selectively at the deoxyguanosine residue was accomplished by use of 3-(p-tolylamino)-1,5-azulenequinone 1 upon irradiation with 350 nm UV light. The single strands were cleaved more efficiently than the double-helices. For the helices containing a deoxyguanosine residue at a bulge, at a hairpin loop or toward the end, the cleaving efficiency was increased. Computation results indicate that two possibilities exist for agent 1 to form two "Watson-Crick type" hydrogen bonds with guanine in single-stranded oligodeoxyribonucleotides; yet, only one possibility exists in duplexes.

Base Sequence↗

"Paper-clip" type triple helix formation by 5'-d-(TC)3Ta(CT)3Cb(AG)3 (a and b = 0-4) as a function of loop size with and without the pseudoisocytosine base in the Hoogsteen strand.

The formation of a DNA "paper-clip" type triple helix (triplex) with a common sequence 5'-d-(TC)(3)T(a)()(CT)(3)C(b)()(AG)(3) (a and b = 0-4) was studied by UV thermal melting experiments and CD spectra. These DNA oligomers form triplexes and duplexes under slightly acidic and neutral conditions, respectively. The stability of the formed triplexes (at pH 4.5) or duplexes (at pH 7.0 or 8.0) does not vary significantly with the size of the loops (a and b = 1-4). At pH 6.0, the triplex stability is, however, a function of a and b. It is also interesting to note that the oligomer 5'-d-(TC)(3)(CT)(3)(AG)(3) (a and b = 0) forms a stable triplex at pH 4.5 with a slightly lower T(m) value, due to dissociation of a base triad at one end and a distorted base triad at the other, observed by (1)H NMR. Thus, we have here a model system, 5'-d-(TC)(3)T(a)(CT)(3)C(b)(AG)(3), that could form a triplex effectively with (a and b = 1-4) and without (a and b = 0) loops under acidic conditions. In addition, the triplex formation of oligomers with replacement of one, two, or three 2'-deoxycytidine in the Hoogsteen strand by either 2'-deoxypseudoisocytidine (D) or 2'-O-methylpseudoisocytidine (M) was also studied in the sequence 5'-d-(TX)(3)T(2)(CT)(3)C(2)(AG)(3) (where X is C, D, or M). Both CD spectra and UV melting results showed that only D3 [(TX)(3) = (TD)(3)] and M3 [(TX)(3) = (TM)(3)] were able to form the paper-clip structure under both neutral and acidic conditions. This is because the N(3)H of a pseudoisocytosine base can serve as a proton donor without protonation. We hereby proved that the 2'-deoxypseudoisocytidine, similar to 2'-O-methylpseudoisocytidine, could replace 2'-deoxycytidine in the Hoogsteen strand to provide triplex formation at neutral pH.

Adenine↗

Influence of 5-bromodeoxycytosine substitution on triplex DNA stability and conformation.

Three triple-helical hairpin DNAs with substitution of 5-bromocytosine for cytosine in different strands have been investigated by molecular mechanics and Raman spectroscopy. The stability of the three substituted triplexes were compared with the corresponding unsubstituted triplex DNA by the molecular mechanics method. Base stacking interactions and strand--strand interactions of each triplex were analyzed in detail. Sugar conformations in these triplexes have been determined by both vibrational spectroscopy and molecular dynamics simulation. The hairpin triplexes with substitution occurring in strand I or both in strands I and III have the main sugar conformation of C3'-endo, while the triplex with substitution occurring in strand III is the combination of C3'-endo and C2'-endo sugar conformation. Theoretical results are basically in agreement with experiments.

Base Sequence↗

Effect of selective substitution of 5-bromocytosine on conformation of DNA triple helices.

Three triplex DNAs containing 5-bromocytosine[BrC] were studied by vibrational spectroscopy and molecular modelling. Firstly, three oligodeoxypyrimidines of 5'-(TC)3-T4-(BrCT)3 [CBrC], 5'-(TBrC)3-T4-(CT)3 [BrCC] and 5'-(TBrC)3-T4-(BrCT)3 [BrCBrC] were synthesized and then reacted with an oligodeoxypurine of 5'-(AG)3 at pH=4.5 in phosphate buffer respectively to form three comparative hairpin triplex named CY,YC and YY. The results of FT-Raman and IR revealed that YY is almost in A-like form, CY and YC are combinations of A-like form and B-like form, but A-form dominates in CY while B-form is equivalent as A-form in YC. The result is consistent with the theoretical analysis.

Cytosine↗

Hydrated water molecules of pyrimidine/purine/pyrimidine DNA triple helices as revealed by FT-IR spectroscopy: a role of cytosine methylation.

Hydrated water molecules of pyrimidine/purine/pyrimidine DNA hairpin triplex was studied by a comparison of triplex (CC.AG6) formed by a host oligodeoxypyrimidine of 5'-d(TC)3T4(CT)3(CC) with a target hexadeoxypurine 5'-d(AG)3(AG6) strand and by triplexes (MM.AG6, MC.AG6, and CM.AG6) formed by oligonucleotides with the exact sequences as above except 5-methylcytosine replaced all (MM), 5' end half (MC), and 3' end half (CM) cytosine bases in CC via FT-IR spectroscopy in hydrated film. Results revealed that: (i) all these triplexes have a similar hydration pattern, in which water molecules probably bound in the N7 sites of adenines and guanines in the Crick-Hoogsteen groove, and to the methyl group of thymidines in the Watson-Hoogsteen groove. There are also some bound water molecules found at the O2 sites of thymines in both Watson-Crick and Crick-Hoogsteen grooves. (ii) In the CC.AG6 triplex the S-type sugars are always dominant in all hydrated states, whereas in MM.AG6 triplex the relative population of the N-type sugars is very close to that of the S-type between 86% and 66% of humidity. Furthermore, the sugar conformation in two partially modified triplexes (CM.AG6, and MC.AG6) are dominant by the N-type at lower humidity. This phenomenon might reflect that the degree of bound water varies among the binding sites of bases. (iii) The effect of introducing a methyl group on cytosine is to generate a spine of hydrophobic region in MM (MC and MC). The enlarging hydrophobic area not only increase the stability in solution, and also the stability in sodium hydrated films of the pyrimidine/purine/pyrimidine hairpin triplexes.

Cytosine↗

Antisense oligodeoxynucleotides of IGF-II selectively inhibit growth of human hepatoma cells overproducing IGF-II.

Insulin-like growth factor II (IGF-II) is expressed in many developing embryonic tissues and is involved in mammalian growth and development. After birth, serum IGF-II is mainly produced by liver cells. Many reports have indicated that IGF-II is overexpressed in some hepatocellular carcinoma (HCC) tissue. These findings imply the possible importance of this growth factor in carcinogenesis. We screened four human HCC cell lines and three rat HCC cell lines and found that HuH-7 and HepG2 cells produced fivefold more intracellular IGF-II than the other cell lines. Experimental data indicate that IGF-II functions through the intracrine mode for HuH-7 cells. To study whether the overexpression of IGF-II is significant for the growth of HCC or only a consequence of HCC development, we used antisense oligodeoxynucleotides (ATON) to arrest the translation of IGF-II mRNA, and then measured the effects on cell growth. We found that the production of IGF-II was suppressed by ATON, and the decrease of IGF-II resulted in growth inhibition of HuH-7 and HepG2. ATON had no effect on the other tested cell lines, which produced lower levels of IGF-II. The growth inhibition was mainly attributed to a decrease of cell proliferative activity. The results indicate that the IGF-II-overproducing cell lines do depend on IGF-II for growth, and ATON of IGF-II can selectively inhibit the growth of these cells. ATON may be a potential therapeutic agent for this type of HCC in vivo.

Animals↗

Interstrand complex formation of purine oligonucleotides and their nonionic analogs: the model system of d(AG)8 and its complement, d(CT)8.

We have investigated the role of purines in interstrand complex formation with regard to substitution of the negatively-charged, phosphodiester backbone by a nonionic, internucleoside linkage. Using the purine oligomer, d(AG)8, its methylphosphonate analog, d(AG)8, and the complementary pyrimidine oligomer, d(CT)8, as a model system, the stoichiometry, conformation, and stability of complexes formed at pH 8 were studied by spectroscopic and electrophoretic methods. When there is only one oligomer species in solution, d(AG)8 behaves as a single-stranded molecule. In contrast, the d(AG)8 oligomer readily forms an intermolecular self-complex, particularly in the presence of magnesium ion. Using either purine oligomer, duplexes can form with the d(CT)8 strand which differ in terms of their conformation and in the dependence of their thermal stability on sodium and magnesium ions. All studies show that a stable triplex forms with a 1:2 d(CT)8:d(AG)8 stoichiometry which does not require high concentrations of sodium or magnesium ions. Triplex formation between the d(CT)8 strand and two d(AG)8 strands was not observed. Native gel electrophoresis suggests that a 1:1:1 d(CT)8:d(AG)8:d(AG)8 complex may be formed. In regard to triplex formation, the advantage of the methylphosphonate backbone on the purine strand is clearly demonstrated.

Circular Dichroism↗

A study of triplex formatin of 5'-d-T-(C-T-)2C-(T-)4C-(T-C-)2T with 5'-d-A-(G-A-)2G A hairpin triplex with three T.A.T and three C+.G.C bases triads.

The UV mixing titration, gel electrophoresis, and CD measurements indicate that oligomers with a basic sequence of 5'-d-T-(C-T-)2C-(T-)4C-(T-C-)2T form a hairpin type triplex with the target 5'-d-A-(G-A-)2G. The stability, measured UV melting temperatures, were studied in aqueous solution as functions of mC (5-methylcytidine) replacement of C, pH (4 to 7), and salt concentrations (up to 1 M). The order of stability is 5'-d-A-(G-A-)2G + 5'-d-T-(C-T-)2C-(T-)4C-(T-C-)2T < 5'-d-A-(G-A-)2G + 5'-d-T-(mC-T-)2mC-(T-)4C-(T-C-)2T approximately 5'-d-A-(G-A-)2G + 5'-d-T-(C-T-)2C-(T-)4 mC-(T-mC-)2T < 5'-d-A-(G-A-)2G + 5'-d-T-(mC-T-)2mC-(T-)4mC-(T-mC-)2T at pH 4. These results indicate that (a) a stable triplex is formed with three T.A.T and three C+.G.C base triads and (b) mC is more effective than C to stablize the triplex formation in acidic condition. Thus, this provides a simple system for further studies of triplex.

Base Sequence↗

DNA triplex formed by d-A-(G-A)7-G and d-mC-(T-mC)7-T in aqueous solution at neutral pH.

Evidence from UV spectroscopic melting experiments indicated that the DNA oligonucleotide 5'-d-A-(G-A)7-G-3' (1), a repeating AG sequence found in the human genome, and its complement 5'-d-mC-(T-mC)7-T-3' (mC: 5-methyl-C) (2), can form both a triplex (with a Tm = 44 degrees C) and a duplex (with a Tm = 69 degrees C) around physiological pH (7.2) in micromolar concentration solution with 0.1 M NaCl. In addition, the triplex can be detected at a pH as high as 8.4 (Tm = 27 degrees C). The stability of the triplex formed by 1 and 2, as monitored by UV melting experiments, is found to increase as the pH is lowered from 8.4 (Tm = 27 degrees C) to 6 (Tm = 79 degrees C). However, the stability of the duplex, formed by 1 and 2, is found to be unchanged (the Tm is approximately 69 degrees C) in the same pH range. There is no triplex, as observed by UV with the oligonucleotides having identical sequences, when the regular cytosine base was used [d-C-(T-C)7-T, (3)] at a pH > 6 in the same concentration range. The stoichiometric ratio of the triplex formed with 1 and 2 is also found to be 1:2 by means of a UV mixing titration study. This result suggests that the conformation of the triplex of 1 and 2 also involves T.A.T and mC+.G.mC base triads. The formation of a triplex by 1 and 2 can be observed by native gel electrophoresis in submicromolar conditions with magnesium ion present. The results of this study strongly support the theory that replacement of regular cytidine nucleotides by 5-methylcytosine nucleotides facilitates the formation of the DNA triplex at physiological pH. This could thus be used an an anti-gene probe via the formation of triplex under the conditions described.

Base Sequence↗

Stereotactic measurement of the sizes of arteriovenous malformations.

A method has been devised for determining the size and location of an arteriovenous malformation (AVM), or brain tumor, using only two X-ray films taken perpendicular to each other. For this method the requirements are that the locations of the films and the X-ray sources must be known. Such requirements are met by BIPLANE POLY DIAGNOST I, an X-ray machine in which both the films and the X-ray sources are set at constant locations. An analytic geometry approach is used to analyze the images in order to determine both the size and position of phantoms placed in or on an experimental box. Analysis of the films generated by phantoms yields a result accurate to within 0.3 mm.

Arteriovenous Malformations↗

The Dewar valence isomer of the (6-4) photoadduct of thymidylyl-(3'-5')-thymidine monophosphate: formation, alkaline lability and conformational properties.

The formation of the Dewar valence isomer of the pyrimidine(6-4)pyrimidone photoadduct of thymidylyl-(3'-5')-thymidine monophosphate (TpT) was investigated under different irradiation conditions. This photoproduct was generated on exposure of TpT to far-UV radiation. However, no detectable amount of the Dewar isomer or its precursor (pyrimidine(6-4)pyrimidone photoadduct) was observed following acetone photosensitization of TpT. The Dewar valence isomer was much more unstable than the pyrimidine(6-4)pyrimidone photoproduct when treated with hot piperidine. A detailed conformational analysis of the TpT Dewar isomer photoproduct is reported as inferred from extensive one- and two-dimensional 300 and 620 MHz proton nuclear magnetic resonance (1H NMR) measurements and molecular mechanics calculations.

Dinucleoside Phosphates↗

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities.

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

Comparative circular dichroism and fluorescence studies of oligodeoxyribonucleotide and oligodeoxyribonucleoside methylphosphonate pyrimidine strands in duplex and triplex formation.

An analogue of the homopyrimidine oligodeoxyribonucleotide d(CT)8 has been synthesized. This analogue, d(CT)8 contains nonionic methylphosphonate internucleoside linkages. The pH-dependent conformational transitions of d(CT)8 have been studied and its ability to form duplexes and triplexes with the normal homopurine oligonucleotide d(AG)8 has also been investigated as a function of pH. Circular dichroism spectroscopy and ethidium bromide fluorescence enhancement have been used to monitor pH-dependent conformational transitions driven by the protonation of cytosine residues, and the different behavior of d(CT)8 and d(CT)8 has been compared. It was possible to form self-associated complexes by using either d(CT)8 or d(CT)8, and both compounds combined with d(AG)8 to form duplex or triplex DNA. At neutral pH, the CD spectrum of d(AG)8.d(CT)8 duplex was quite different from the CD spectrum of d(AG)8.d(CT)8 duplex, reflecting most likely a difference in conformation. The duplex to triplex transition characteristic of this DNA sequence occurred at a lower pH when d(CT)8 was substituted for d(CT)8; however, at pH 4.2, triplex containing d(CT)8 was similar in conformation to triplex containing d(CT)8. Several of these observations can be related to the alterations in electrostatic and steric interactions that occur when the negatively charged phosphodiester backbone of d(CT)8 is replaced with a nonionic methylphosphonate backbone.

Circular Dichroism↗

NMR studies of intracellular water at 300 MHz: T2-specific relaxation mechanisms in synchronized or EGF-stimulated cells.

Responses specific to the spin-spin relaxation time (T2) have been observed in two time-dependent studies of the intracellular water in normal and transformed Syrian hamster fetal fibroblasts. At 300-MHz (7.0 T), the spin-lattice relaxation time (T1) was insensitive to several aspects of cellular physiology that produced changes in the T2 and the apparent self-diffusion coefficient (Dapp) of intracellular water. In normal cells stimulated with epidermal growth factor (EGF), T1 was insensitive to time-dependent changes detected by T2 and Dapp. In synchronized tumor cells, T1 was insensitive to cell-cycle-dependent changes detected by T2. The strongly coupled behavior of T2 and Dapp that was observed as a function of time in EGF-stimulated cells indicates that the diffusion of intracellular water through inhomogeneous local magnetic field gradients produced effects observable in T2. Conformational changes in large intracellular macromolecular assemblies such as chromatin or the cytoskeleton may alter the magnitude and inhomogeneity of local field gradients, producing responses in T2 and Dapp only.

Animals↗

Studies of the T1 and T2 of intracellular water as a function of frequency in normal and transformed fetal cells.

Frequency-dependent values of the spin-lattice relaxation time (T1) and the spin-spin relaxation time (T2) have been obtained for intracellular water in normal and transformed Syrian hamster fetal fibroblasts. Values of T1 and T2 were obtained for normal and transformed cells at 24.3 (0.57 T), 100 (2.4 T), 300 (7.0 T), and 400 MHz (9.4 T). At each frequency, values of T1 were the same for both normal and transformed cells, whereas values of T2 were lower for one passage of transformed cells. As expected, T1 increased with frequency. However, T2 decreased with frequency for both normal and transformed cells. The frequency dependence of T2, was similar for all cells; thus, the ability of T2 to make a distinction between normal and transformed cells did not change with field.

Animals↗

Proton NMR and optical spectroscopic studies on the DNA triplex formed by d-A-(G-A)7-G and d-C-(T-C)7-T.

Triplex and duplex formation of two deoxyribohexadecamers d-A-(G-A)-G (a) and d-C-(T-C)-T (b) have been studied by UV, CD, fluorescence, and proton NMR spectroscopy. Optical studies of a and b at dilute concentrations (microM range) yielded results similar to those seen for polymers of the same sequence, indicating that these hexadecamers have properties similar to the polymers in regard to triplex formation. The CD spectra of concentrated NMR samples (mM range) are similar to those observed at optical concentrations at both low and high pH, making possible a correlation between CD and NMR studies. In NMR spectra, two imido NH-N hydrogen bonded resonance envelopes at 12.6 and 13.7 ppm indicate that only the duplex conformation is present at pH greater than 7.7. Four new NH-N hydrogen-bonded resonance envelopes at 12.7, 13.5, 14.2, and 14.9 ppm are observed under acidic conditions (pH 5.6) and the two original NH-N resonances gradually disappear as the pH is lowered. Assignment of these four peaks to Watson-Crick G.C. Hoogsteen T.A Watson-Crick A.T, and Hoogsteen C+.G hydrogen-bonded imidos, respectively, confirm the formation of triple-stranded DNA NMR results also show that triplex is more stable than duplex at the same salt condition and that triplex melts to single strands directly without going through a duplex intermediate. However, in the melting studies, a structural change within the triple-stranded complex is evident at temperatures significantly below the major helix-to-coil transition. These studies demonstrate the feasibility of using NMR spectroscopy and oligonucleotide model compounds a and b for the study of DNA triplex formation.

Circular Dichroism↗

Synthesis and characterization of stereoisomers of 5,6-dihydro-5,6-dihydroxy-thymidine.

Six products were isolated by reverse phase HPLC from the reaction of thymidine with osmium tetroxide. Four of the products were identified as stereoisomers of 5,6-dihydro-5,6-dihydroxy-thymidine (TG). The absolute configurations of these four compounds (from the shortest to the longest HPLC retention times) were determined by two-dimensional nuclear magnetic resonance spectroscopy to be (-)-trans-5S,6S-, (+)-trans-5R,6R-, (-)-cis-5R,6S-, and (+)-cis-5S,6R-5,6-dihydro-5,6-dihydroxy-thymidine. The other two products were dimers with unknown linking sites. Parameters of the mass and nuclear magnetic resonance spectra are reported and discussed.

Chromatography, High Pressure Liquid↗