Biomedical subjects

L Tseng

Publications and source records attributed to L Tseng.

At least 19 recordsLinked to original sources

PubMed2004

Disparate effects of relaxin and TGFbeta1: relaxin increases, but TGFbeta1 inhibits, the relaxin receptor and the production of IGFBP-1 in human endometrial stromal/decidual cells.

BACKGROUND: The purpose of this study was to determine the effect of progestin, relaxin (RLX) and transforming growth factor beta1 (TGFbeta1) on the content of relaxin receptor (LGR7) mRNA. The effect of RLX on insulin-like growth factor binding protein-1 (IGFBP-1) production was determined to evaluate the biological function of RLX/receptor in human endometrial cells. METHODS AND RESULTS: The levels of LGR7 mRNA and the effect of hormones were determined by real-time PCR in endometrial cells. LGR7 mRNA was found to be relatively abundant in endometrial glands and decidual cells and much less in endometrial stromal cells. In stromal cells, medroxyprogesterone acetate (MPA), or MPA plus RLX, significantly increased the LGR7 mRNA and RLX alone had little effect. In decidual cells, RLX increased LGR7 mRNA in a dose- and time-dependent fashion. TGFbeta1 reduced the LGR7 mRNA. In stromal cells, MPA alone caused a slight increase (2-4-fold) of the production rate of IGFBP-1 whereas MPA plus RLX synergistically increased (>40-fold) the IGFBP-1 production. In decidual cells in which the basal production rate was already approximately 50-fold higher than in stromal cells, RLX alone caused an additional increase (>30-fold) on the production rate. TGFbeta1 inhibited the IGFBP-1 production. CONCLUSION: The present study showed that in undifferentiated endometrial stromal cells, progestin increases the RLX receptor content to enhance the effect of RLX on the target gene (IGFBP-1). In decidual cells, RLX alone up-regulates its receptor, resulting in a large scale induction of IGFBP-1. TGFbeta1 has an inhibitory effect on LGR7 and IGFBP-1.

Cells, Cultured↗

PubMed2004

Functional neurosurgery in the MRI environment.

OBJECTIVE: The purpose of this study was to evaluate the feasibility of microelectrode recording, electrical stimulation, and electrode position checking during functional neurosurgical procedures (DBS, lesion) in the interventional magnetic resonance imaging (iMRI) environment. METHODS: Seventy-six surgical procedures for DBS implant or radiofrequency lesion were performed in an open 0.2 T MRI operating room. DBS implants were performed in 54 patients (72 surgical procedures) and unilateral radiofrequency lesions in three for a total of 76 surgeries in 57 patients. Electrophysiological studies including macrostimulation and microelectrode recordings for localization were obtained in the 0.5 to 10 mT fringes of the magnetic field in 51 surgeries. MRI confirmation of the electrode position during the procedure was performed after electrophysiological localization. RESULTS: The magnetic field associated with the MRI scanner did not contribute significant noise to microelectrode recordings. Anatomical confirmation of electrode position was possible within the MRI artifact from the DBS hardware. Symptomatic hemorrhage was detected in two (2.6 %) patients during the operation. Image quality of the 0.2 T MRI scan was sub-optimal for anatomical localization. However, image fusion with pre-operative scans permitted excellent visualization of the DBS electrode tip in relation to the higher quality 1.5 T MRI anatomical scans. CONCLUSION: This study shows that conventional stereotactic localization, microelectrode recordings, electrical stimulation, implant of DBS hardware, and radiofrequency lesion placement are possible in the open 0.2 T iMRI environment. The convenience of having an imaging modality that can visualize the brain during the operation is ideal for stereotactic procedures.

Adolescent↗

PubMed2001

Ligand activated hPR modulates the glycodelin promoter activity through the Sp1 sites in human endometrial adenocarcinoma cells.

Human endometrium produces glycodelin-A (GdA). The GdA mRNA is highly expressed in progestin-sensitized human endometrial glandular epithelial cells. The mechanism of GdA gene expression, however, is not clear. To understand the cell specific GdA gene transcription, our first approach was to identify the cis-element in the GdA promoter using transfection assay in a human endometrial adenocarcinoma cell line (HEC-1B, a cell line originally derived from the glandular component of the endometrium). The GdA promoter (-1900 to +20 bp) was linked to the luciferase reporter gene to construct p1900Luc, along with two shorter promoter constructs, p1100Luc and p304Luc. Deletion analysis showed that the basal promoter activity was derived from the region between -304 to +20 bp. This region contains three putative Sp1 binding sites (Sp1-1, -243 to -238 bp; Sp1-2, -207 to -202 bp; and Sp1-3, -56 to -49 bp). Mutation analysis at the Sp1 sites showed that p304Spm2Luc and p304Spm3Luc reduced the activity by 80%, while p304Spm1-2-3Luc reduced the activity by 95%. Sp1-1 mutation, however, had no effect. These results showed that two of the three Sp1 cis-elements mediate the basal promoter activity of the GdA gene. Electrophoretic gel mobility shift showed that at least two specific binding proteins in the nuclear extracts of HEC-1B cells bound to the oligo containing Sp1-2 or Sp1-3 cis-element. Sp1 antibody reduced the specific binding complex by 70% suggesting that Sp1 transcription factor regulates GdA gene expression. In addition, over expression of Sp1 increased the promoter activity. To determine whether progestin would modulate the promoter activity, HEC-1B cells were transfected with p304Luc and with progesterone receptor (either hPR-A or hPR-B) expression vector. Medroxyprogesterone acetate increased the promoter activity (3-fold) derived from p304Luc but not from the mutant, p304Spm1-2-3Luc. In contrast, the promoter activity was slightly reduced in cells treated with estradiol and co-transfected with estrogen receptor expression vector. These data indicate that ligand-activated PR stimulates GdA gene expression mediated through the functional Sp1 sites.

Adenocarcinoma↗

PubMed2001

The anti-anginal drug fendiline increases intracellular Ca(2+) levels in MG63 human osteosarcoma cells.

The effect of fendiline, an anti-anginal drug, on cytosolic free Ca(2+) levels ([Ca(2+)](i)) in MG63 human osteosarcoma cells was explored by using fura-2 as a Ca(2+) indicator. Fendiline at concentrations between 1 and 200 microM increased [Ca(2+)](i) in a concentration-dependent manner and the signal saturated at 100 microM. The Ca(2+) signal was inhibited by 65+/-5% by Ca(2+) removal and by 38+/-5% by 10 microM nifedipine, but was unchanged by 10 microM La(3+) or verapamil. In Ca(2+)-free medium, pre-treatment with 1 microM thapsigargin (an endoplasmic reticulum Ca(2+) pump inhibitor) to deplete the endoplasmic reticulum Ca(2+) store inhibited fendiline-induced intracellular Ca(2+) release. The Ca(2+) release induced by 50 microM fendiline appeared to be independent of IP(3) because the [Ca(2+)](i) increase was unaltered by inhibiting phospholipase C with 2 microM U73122. Collectively, the results suggest that in MG63 cells fendiline caused an increase in [Ca(2+)](i) by inducing Ca(2+) influx and Ca(2+) release in an IP(3)-independent manner.

Calcium↗

PubMed2000

Partial characterization of the CCAAT box in the promoter of the hLGFBP-1 gene: interaction with negatively acting transcription factors in decidualized human endometrial stromal cells.

The CCAAT cis-element and its adjacent DNA sequence (-82 to -52 bp) in the human insulin-like growth factor binding protein-1 gene (IGFBP-1) promoter are active in both decidualized human endometrial stromal cells and HepG2 cells. In HepG2 cells, CCAAT activity is mediated by interacting with hepatocyte nuclear factor, HNF-1. In endometrial cells, this region is protected by the nuclear extracts of endometrial decidual cells, however, the transactivator which interacts with the region has not been identified. This study was carried out to characterize and identify the stromal/decidual nuclear proteins that interact with the IGFBP-1 CCAAT motif. Gel shift analysis showed that the CCAAT motif (-82 to -52 bp) formed three specific complexes (CI, CII, and CIII) by extracts from human endometrial decidual or stromal cells. The intensity of CIII formed by the nuclear extracts of decidual cells was less compared to that formed by stromal cells whereas CI/CII was found to be opposite. To evaluate the transcription factors that bind to this region, a number of known CCAAT binding proteins were tested. Among them, the CCAAT binding proteins NF-Y (alpha2(1) collagen promoter CCAAT binding protein) and CBF (hsp70 promoter CCAAT binding protein), were characterized by the gel shift assay. The NF-Y consensus binding sequence (the alpha2(1) collagen promoter) and NF-YA,B antibody abolished or shifted CIII. Although the CBF consensus binding sequence (the hsp70 promoter) eliminated all three complexes, the antibody to CBF had no effect on all three complexes. The nuclear extracts of the endometrial stromal/decidual cells did not form a band corresponding to the HNF-1/CCAAT complex. These results indicate that the CCAAT motif binds to NF-Y and the CI/CII binding protein (remains to be identified) but not HNF-1 in endometrium. Systematic mutation in the CCAAT motif showed that NF-Y(CIII binding protein) bound to the 12 bp sequence GGCGCTGCCAAT(-79 to -68 bp) and the CI/CII binding protein bound to 9 bp, TGCCAATCA(-74 to -66 bp). These findings indicate that the CCAAT motif is a composite element. The CCAAT mediated function was analyzed in decidualized endometrial stromal cells. Mutations in the CCAAT motif increased the promoter activity. The maximum activity was found in mutants which abolished the NF-Y complex. The CCAAT core sequence mutants in which both CIII and CI/CII were abolished, also increased the promoter activity. Results indicated that NF-Y and the CI/CII binding protein, yet to be identified, interact with the composite CCAAT element in the IGFBP-1 promoter to repress the promoter activity in endometrial decidual cells.

Base Sequence↗

PubMed2000

Characterization of the antinociceptive effects of TRK-820 in the rat.

We have already reported that TRK-820, (-)-17-cyclopropylmethyl-3, 14b-dihydroxy-4, 5a-epoxy-6b-[N-methyl-trans-3-(3-furyl)acrylamido]morphinan hydrochloride, a new selective kappa-opioid receptor agonist, has affinity for kappa-subtype opioid receptors other than the kappa(1)-opioid receptor. It would be of interest to examine whether the different kappa-opioid receptor subtype properties of TRK-820 participate in its antinociceptive action in the inflamed paw test and the formalin test. TRK-820 produced a potent antinociceptive effect, which was inhibited by the selective kappa-opioid receptor antagonist nor-binaltorphimine, but not by the mu-opioid receptor antagonist naloxone in the mechanical paw pressure test. TRK-820 also produced a potent antinociceptive effect in rats with adjuvant-induced arthritis. TRK-820 and morphine, a prototype mu-opioid receptor agonist, were equally effective in inhibiting the nociceptive responses in the arthritic rats and in the normal rats, while ICI-199441, 2-(3, 4-dichlorophenyl)-N-methyl-N-[(1S)-1-phenyl-2-(1-pyrrolidinyl)ethyl]- acetamide, a kappa-opioid receptor agonist, was about 5-fold less potent in the arthritic rats than in the normal rats. In the formalin test TRK-820 had a very similar antinociceptive potency to that of ICI-199441, unlike in the arthritic rats in which TRK-820 was 2.5 times more potent than ICI-199441. It is concluded that TRK-820 produced a potent antinociceptive action via the stimulation of kappa-opioid receptors in rats. TRK-820 has a unique antinociceptive profile different from that of the other kappa-opioid receptor agonists such as ICI-199441 in arthritic rats.

Analgesics, Opioid↗

PubMed2000

Ligand-activated progesterone receptor isoform hPR-A is a stronger transactivator than hPR-B for the expression of IGFBP-1 (insulin-like growth factor binding protein-1) in human endometrial stromal cells.

In human endometrium, the levels of progesterone receptor (PR) isoforms hPR-A and hPR-B are differentially regulated during the reproductive cycle. Progesterone significantly increases the content of hPR-A, the predominant isoform in decidualized stromal cells (1). The purpose of this study was to determine the capacity of hPR-A and hPR-B to transactivate the progestin-dependent target gene in human endometrial stromal cells. We examined the effect of cotransfection of hPR-A or hPR-B on the expression of the human insulin-like growth factor binding protein-1 (IGFBP-1) in endometrial stromal cells. The primary culture of human endometrial stromal cells was transfected with the hPR-A or hPR-B expression vector and the IGFBP-1 promoter construct p275CAT, which contains two functional progesterone response elements (PRE1 and PRE2) in decidualized stromal cells. Medroxyprogesterone acetate (MPA) increased the promoter activities ranging from 1.2- to 27-fold in cells cotransfected with hPR-A or hPR-B in eight endometrial specimens. The promoter activity increased by the hPR-A was significantly higher than hPR-B (15 +/- 8 vs. 4 +/- 2, mean +/- SD; n = 8, P < 0.005). Site-specific mutation showed that the induced activity by hPR-A was mediated through the PRE1 and PRE2 sites. Addition of hPR-B reduced the effect of hPR-A. The high transactivation capacity of hPR-A was also activated by other ligands, progesterone, Org 2058, and norethindrone. These observations indicate that hPR-A is a stronger transactivator than hPR-B for the IGFBP-1 promoter in endometrial stromal cells. Previous studies have shown the progestin-dependent production of IGFBP-1 correlates with its mRNA levels and transcription rate. Thus, we have determined the effect of hPR-A and hPR-B on the production of IGFBP-1 in stromal cells treated with MPA. The production rate in cells uniformly infected with AdPRA (recombinant Ad5-directed PR expression system) was significantly higher (P < 0.001) than the rate in uninfected cells and in cells infected with AdPRB or AdCMV (the Ad5 viral expression vector). This result, in concert with the promoter analysis, provides evidence that hPR-A is a strong inducer for the chromosomal IGFBP-1 gene in endometrial stromal cells.

Adult↗

PubMed1999

Activation of the insulin-like growth factor binding protein-1 promoter by progesterone receptor in decidualized human endometrial stromal cells.

Insulin-like growth factor binding protein-1 (IGFBP-1) is induced extensively when human endometrial stromal cells are decidualized by progestin and relaxin in a long-term primary culture system. The purpose of this study is to investigate whether progesterone receptor (PR) directly activates the IGFBP-1 gene promoter. In decidualized stromal cells, activity of the IGFBP-1 promoter (from -1.2 kb to +68 bp) containing putative progesterone-response elements (PREs) was increased 80-fold. Mutation of either 5' or 3' half-site of the putative PRE1 site (from -193 to -179 bp) reduced the promoter activity. Mutations that converted PRE1 closer to consensus PRE increased the promoter activity. In undifferentiated stromal cells, mutations of PRE sites had no effect on the promoter activity. When a PR expression vector (hPR1) was cotransfected, progestin increased promoter activity derived from p275CAT but not from p1.2CAT, suggesting that the function of PRE1 was repressed by the region from -1.2 kb to -275 bp in the promoter. Progestin did not increase promoter activity derived from p275CAT without cotransfection of hPR1, suggesting that endogenous PR alone is insufficient to activate PRE1. In summary, results indicate that the PRE1 site of the IGFBP-1 promoter mediates a direct activation of PR on transcription specifically in decidualized stromal cells.

Adult↗

PubMed1999

Potent antinociceptive effects of TRK-820, a novel kappa-opioid receptor agonist.

TRK-820, a new type of 4,5-epoxymorphinan derivative, was investigated in vivo for antinociceptive activities and its selectivity on various opioid receptors in mice. TRK-820 given s.c. or p.o. was found to be 351- and 796-fold more potent than U50,488H with acetic acid-induced abdominal constriction test. The duration of the antinociceptive effect produced by TRK-820 was longer than that produced by mu-opioid receptor agonist morphine or other kappa-opioid receptor agonists. In addition, with four other antinociceptive assays, low temperature hot plate (51 degrees C), thermal tail flick, mechanical tail pressure and tail pinch tests, TRK-820 was also found to be 68- to 328-fold more potent than U-50488H, and 41- to 349-fold more potent than morphine in producing antinociception, as comparing the weight of the different compound. However, TRK-820 was less active in inhibiting the high temperature (55 degrees C) hot plate response. The antinociceptive effects produced by TRK-820 were inhibited by nor-BNI, but not by naloxone or naltrindole (NTI) with the abdominal constriction test, indicating that the antinociception is selectively mediated by the stimulation of kappa-, but not mu- or delta-opioid receptors. Co-administration of TRK-820 with morphine slightly enhanced the antinociception induced by morphine in the mouse hot plate test. On the other hand, pentazocine significantly reduced the morphine-induced antinociception. TRK-820 produced sedation at doses, which are much higher than the doses for producing antinociception. These results indicate that the potent antinociception induced by TRK-820 is mediated via the stimulation of kappa-, but not mu- or delta-opiod receptors.

Administration, Oral↗

PubMed1999

Prolactin and its receptor in human endometrium.

Synthesis of prolactin (PRL) in human endometrium extends from the late luteal phase of the menstrual cycle throughout the pregnancy. We have studied the hormonal requirements for the sustained production of PRL and its receptor (PRL-R) in a long-term primary cell culture system. Progestin stimulates the production PRL and its receptor when stromal cells transform into decidual cells. The rise in PRL production rate correlates with an increase in steady-state PRL mRNA levels which are caused by increased transcription rate gene. Replacing progestin by the antiprogestin, RU 486, causes a transient superinduction of PRL production followed by reduction to basal level of expression. On the other hand, RU 486 exerts immediate inhibition of PRL-receptor mRNA expression. In addition, relaxin (RLX) enhances PRL synthesis. The transcription of the PRL gene in endometrium is dependent upon the promotor 6-kb upstream of the transcription start site in the pituitary. That biological functions of PRL and its receptor are critical to implantation and the maintenance of pregnancy is suggested by the impaired fertility of PRL and PRL-R knockout mice. PRL enhances endometrial cell growth at low concentrations and inhibits it at high concentrations. This dual action indicates an autocrine action of PRL-R-mediated signaling transduction pathways during reproductive cycles and pregnancy. During gestation, decidual-derived prolactin regulates the volume of amniotic and fetal extracellular fluid and electrolytes.

Cells, Cultured↗

PubMed1999

Relaxin stimulates glycodelin mRNA and protein concentrations in human endometrial glandular epithelial cells.

Human endometrium is the major organ that produces glycodelin A (GdA). The production of endometrial GdA causes a fluctuation of the peripheral glycodelin concentrations in women during the menstrual cycle and pregnancy. It has recently been reported that the rise of plasma concentrations of glycodelin is correlated with relaxin during the late luteal phase and early pregnancy. In addition, administration of relaxin increases glycodelin plasma concentrations, suggesting that relaxin induces GdA production in endometrium. To investigate whether relaxin regulates the GdA synthesis, human endometrial glandular epithelial cells were isolated and cultured with or without relaxin for up to 4 days. Western blot showed that GdA synthesized and secreted from epithelial glands had a major molecular weight of 28 kDa, i.e. the same as the GdA isolated from amniotic fluid. Cells incubated with relaxin consistently increased in GdA production rate (2-6-fold). The GdA mRNA concentrations increased 2-11-fold in cells incubated with relaxin for 2-4 days, as determined by solution hybridization/ribonuclease protection assay. The increase of the mRNA concentration indicates that relaxin activates GdA transcription.

Adult↗

PubMed1998

Effects of decidua-conditioned medium and insulin-like growth factor binding protein-1 on trophoblastic matrix metalloproteinases and their inhibitors.

The regulatory role of in vitro decidualized stromal cells (DESCM) and their main secretory product insulin-like growth factor binding protein-1 (IGFBP-1) was studied on the secretion of trophoblastic gelatinases and tissue inhibitor of metalloproteinase (TIMP-1). First trimester cytotrophoblastic cells (CTB) were obtained from abortions and cultured in vitro in presence or absence of DESCM or IGFBP-1. Secreted gelatinases were analysed in the culture supernatants by zymography and by measurements of the total gelatinolytic activity. TIMP-1, hCG, and fetal fibronectin (fFN) were measured by commercially available immunoassays. DESCM inhibited the total gelatinolytic activity of CTB but increased trophoblastic MMP-9, TIMP-1 and fFN. In contrast, IGFBP-1 increased the total gelatinolytic activity and TIMP-1, had no effect on MMP-2 , MMP-9 or fFN but inhibited hCG. It is concluded that a factor secreted by decidual cells inhibits the gelatinolytic property of trophoblast by increasing TIMP-1. Other decidual factors, as yet unidentified, increase MMP-2 and MMP-9 to an extent which does override the inhibitory effect of TIMP-1. Since in contrast to DESCM, IGFBP-1 increases the total gelatinolytic activity of CTB, it cannot be the primary active decidual factor regulating the proteolytic activity of CTB. The possibility of an integrin-mediated effect of IGFBP-1 on CTB is discussed.

Adult↗

PubMed1997

Differentiation-dependent and cell-specific regulation of the hIGFBP-1 gene in human endometrium.

We analyzed IGFBP-1 gene promoter activity by transient transfection during the progressive decidualization of human endometrial stromal cells. A time study over a 13-day culture period showed that the promoter activity increased exponentially to > 10(4) fold in cells treated with MPA and RLX correlating with the secretion rate and steady-state mRNA levels of the endogenous gene. Deletion analysis showed that two regions in the IGFBP-1 gene promoter are responsible for the activation of the IGFBP-1 gene. The basal promoter region between -1 and -300 bp contains multiple sections of functional elements homologous either to CRE, PRE, or CCAAT. The major difference of IGFBP-1 gene activation in endometrium and the hepatic system lies in the distal promoter region, between -2.6 and -3.4 kb, which mediates 95% of the total promoter activity derived from -3.3 kb to +68 bp. Functional and binding analysis in the distal promoter region showed that multiple Sp1 elements interacting with a novel Sp3 transcription factor activates the hIGFBP-1 gene promoter.

Cell Differentiation↗

PubMed1997

Regulation of progesterone receptor messenger ribonucleic acid by progestin in human endometrial stromal cells.

Down-regulation of the progesterone receptor (PR) by its ligand has been demonstrated in breast cancer cell lines and in the rat uterus. However, in the stromal cells of endometrium, reduction of the PR level is not apparent in the luteal phase of the menstrual cycle. The purpose of this study was to determine the effect of progestin on PR and PR mRNA in isolated human endometrial stromal cells. Western blot analysis showed that progesterone or medroxyprogesterone acetate increased the two isoforms, PR-A and PR-B, in stromal cells but reduced them in glandular epithelial cells. Progestin increased the PR-A and PR-B mRNA by 2- to > 10-fold in the stromal cells of 12 specimens measured by solution hybridization-ribonuclease protection assay. A time study showed that the increase in PR mRNA required at least a 2- to 3-day incubation with progestin and that the high mRNA levels were maintained or increased slightly beyond 10 days of progestin incubation. The stimulatory effect of progestin was inhibited by RU-486 and by cycloheximide, suggesting that the up-regulation requires ligand binding to PR and de novo protein synthesis. Progestin also increased the stability of PR mRNA in endometrial stromal cells. These results demonstrated for the first time that progestin exerts an up-regulation of PR by increasing the steady-state level of PR mRNA specifically in human endometrial stromal cells. The up-regulation of PR by progestin may be mediated in part by progestin-induced endometrial stromal cell factors such as estrogen and insulin-like growth factor-I, both of which stimulated the PR-A and PR-B mRNA in stromal cells.

Cycloheximide↗

PubMed1997

Progesterone receptor (PR) inhibits expression of insulin-like growth factor-binding protein-1 (IGFBP-1) in human endometrial cell line HEC-1B: characterization of the inhibitory effect of PR on the distal promoter region of the IGFBP-1 gene.

Progestin has been shown to have both stimulatory and inhibitory effects on the expression of insulin-like growth factor binding protein-1 (IGFBP-1) in human endometrial cells. In this study, progestin was found to reduce levels of secreted IGFBP-1 and IGFBP-1 messenger RNA and IGFBP-1 promoter activity after stably transfecting a progesterone receptor (PR; B form) expression vector into HEC-1B cells. Deletion analysis of the IGFBP-1 promoter revealed that PR specifically inhibited promoter activity derived from a 59-bp distal BsaHI/RsaI fragment. It was concluded that PR inhibited the promoter activity through protein-protein interactions based on the facts that 1) no progesterone-responsive element was revealed by a series block mutation in the BsaHI/RsaI fragment; 2) PR bound by the antiprogesterone ZK98299 inhibited IGFBP-1 promoter activity; 3) a DNA-binding mutant of PR inhibited the IGFBP-1 promoter activity; and 4) in an in vivo competition assay, the DNA-binding domain of PR did not release the inhibitory effect of intact PR. Analysis of PR deletion mutants indicated that both transcriptional activation domains of PR (TAF-1 and TAF-2) were involved in the inhibition of IGFBP-1 expression. Thus, our data may explain the superinduction of IGFBP-1 in human endometrial cells after progestin withdrawal or progestin replacement with antiprogestin.

Base Sequence↗

PubMed1996

Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells.

The purpose of this study was to identify the nuclear components that account for a dramatic transcriptional induction of the human insulin-like growth factor binding protein-1 (IGFBP-1) gene in decidualized human endometrial stromal cells. The study focused on the functional analysis and binding characteristics of the two distal promoter regions, 132 bp -2.732 to -2.6 kb [C/al/Xbal, (CX) fragment] and 30 bp [-2830 to -2800 bp, Hincll/ Sphl [HS] fragment]. In the primary culture of endometrial stromal cells, we have examined the three cis-elements, I, II and III, in the 58-bp BsaHl/ Rsal (BR) fragment (a promoter fragment that resides in CX) previously identified in HEC-1B cells. When pBRPL (BR 5'-linked to -2600 to +68 bp IGFBP-1 promoter/chloramphenicol acetyl transferase gene) was transfected into cells, only cis-element II (-2660 to -2638 bp) mediated the activation, whereas I and III (-2675 to -2666 bp and -2637 to -2628 bp) were inactive in both unstimulated and hormone-stimulated endometrial stromal cells. Promoter activity derived from pCXPL was repressed in unstimulated cells. During decidualization of endometrial stromal cells, the repression was gradually diminished, which was mediated by cis-element I and III. The binding pattern of the BR fragment analyzed by electrophoretic mobility shift assay using nuclear extracts of decidual tissue or cells showed three major specific binding complexes, C1, C2, and C3, which were abolished by a complementary oligonucleotide of the Sp1-binding motif dose-dependently. Only two complexes, C2 and C3, were formed by nuclear extracts of unstimulated stromal cells. A binding study with mutated BR fragment showed that the binding sites of C1, C2, and C3 resided at cis-elements I and III. The Sp3 antibody abolished complexes C1, C2, and C3. The Sp1 and Sp4 antibodies, however, had little effect. The other distal promoter region, 30-bp HS fragment, which contains a core sequence homologous to the Sp1-binding motif, formed a complex with mobility similar to C1. It is transcriptionally active only in decidualized stromal cells. The binding protein of this complex recognized the Sp3 antibody. Immunoblot analysis of the nuclear extracts of stromal and decidual cells showed that Sp3 antibody identified 120-, 82-, and 80-kDa Sp3 proteins. An additional 28-kDa Sp3 protein was present only in the extract of decidual cells. These findings suggest that decidual Sp3 protein may be responsible, at least in part, for the transcriptional regulation in decidualized endometrial stromal cells.

Adult↗

PubMed1995

Progestin and antiprogestin differentially regulate the expression of insulin-like growth factors (IGF-I and IGF-II) messenger ribonucleic acid in human endometrial stromal cells.

Previous studies have shown that insulin-like growth factors (IGF-I and IGF-II) stimulate mitogenic activity in human endometrial stromal cells. In the present study, we have investigated the expression of IGF-I and -II mRNA to ascertain any autocrine growth-promoting effect in this system. Northern blot analysis revealed that endometrial stromal cells express multiple sizes of IGF-I and -II transcripts. The effect of progestin and antiprogestin was studied during decidualization of endometrial stromal cells in long-term culture. Solution hybridization and a ribonuclease protection assay of control cells revealed that the level of IGF-I mRNA was low, whereas IGF-II mRNA was always abundant. Medroxyprogesterone acetate (MPA) stimulated the expression of IGF-I mRNA > 4-fold in predecidualized cells during the first 10 days of culture. IGF-I mRNA decreased to basal level in prolonged culture when cells were decidualized. In contrast, MPA suppressed the IGF-II mRNA level by 60% in predecidualized cells, but IGF-II mRNA was highly expressed after 20 days of incubation with MPA (5-fold increase from Days 5-10 to Day 20 of culture). In progestin-pretreated cells, addition of the antiprogestin RU486 for 1-4 days reduced IGF-I mRNA by 50-90%. RU486 reversed the suppressive effect of MPA and increased IGF-II mRNA. This study indicates that progestin and antiprogestin differentially regulate IGF-I and IGF-II mRNA levels in human endometrial stromal cells.

Cells, Cultured↗

PubMed1995

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)

Adenocarcinoma↗