Effects of base analog substitutions in the noncoding dC of the 3'-d(CTG)-5' template recognition site of the bacteriophage T7 primase.
The 63-kDa gene 4 protein (DNA primase) of bacteriophage T7 catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC at single-stranded DNA recognition sites 3'-d[CTGG-(G/T)]-5' and 3'-d(CTGTG)-5', respectively. At these sites, the 3'-terminal deoxycytidine residue is conserved but noncoding; the 3'-dC residue is required to initiate catalytic synthesis of oligoribonucleotides, yet it is not used as a template residue for the synthesis of a complementary G residue in the RNA primer. We have examined the interactions between T7 primase and the functional groups of the 3'-dC residue by measuring the ability of the primase to catalyze the synthesis of oligoribonucleotides on synthetic single-stranded 20-mer templates [e.g., 3'-d(GCTATGGTGACTGGTAGTCG)-5'] that contain analogs of dC in the conserved pentanucleotide recognition site. Recognition sites containing 5-methyldeoxycytidine (m5dC) or 1-(beta-D-2'-deoxyribosyl)-2-pyrimidinone (dH4C) substitutions for dC support oligoribonucleotide synthesis whereas those containing deoxythymidine (dT) and deoxyuridine (dU) substitutions do not. Oligoribonucleotide synthesis on the native template (containing dC) is inhibited competitively by the template containing a dT residue in the primase recognition site, 3'-[(N10)TTGGT(N5)]-5', with an apparent Ki of 1.30 +/- 0.04 microM. Templates containing dU residues, 3'-[(N10)UTGGT(N5)]-5' and 3'-[(N9)UTTGGT-(N5)]-5', affect both the apparent Km and Vmax parameters for oligoribonucleotide synthesis on the 3'-[(N10)CTGGT(N5)]-5' template.