PubMed Health⌕ Search

Biomedical subjects

L W McLaughlin

Publications and source records attributed to L W McLaughlin.

At least 37 records · Page 2Linked to original sources
PubMed1996

Importance of specific adenosine N3-nitrogens for efficient cleavage by a hammerhead ribozyme.

Five modified hammerhead ribozyme/substrate complexes have been prepared in which individual adenosine N3-nitrogens have been excised and replaced with carbon. The modified complexes were chemically synthesized with the substitution of a single 3-deazzaadenosine (c3A) base analogue for residues A6, A9, A13, A14, or A15.1. Steady-state kinetic analyses indicate that the cleavage efficiencies, as measured by kcat/K(M), for the c3A6, c3A9, and c3A14 complexes were only marginally reduced (< or = 5-fold) relative to the native complex. By comparison, the cleavage efficiencies for the c3A13 and c315.1 complexes were reduced by 9-fold and 55-fold, respectively. these reductions in cleavage efficiency are primarily a result of lower kcat values. Profiles of pH and cleavage rate suggest that the chemical cleavage step is the rate-limiting reaction for these complexes. These results suggest that the N3-nitrogen of the A13 residue and particularly the A15.1 residue in the hammerhead ribozyme/substrate complex are critical for transition state stabilization and efficient cleavage activity. We have additionally compared the locations of these critical functional groups, as well as those identified from other studies, with recent crystallographic analyses. In some cases, the critical functional groups are clustered around proposed metal binding sites and may reflect functional groups critical for binding the metal cofactor. In other cases, clusters of functional groups may form a network of hydrogen bonds necessary for transition state stabilization.

Base Sequence↗
PubMed1996

Use of a pyrimidine nucleoside that functions as a bidentate hydrogen bond donor for the recognition of isolated or contiguous G-C base pairs by oligonucleotide-directed triplex formation.

Synthesis of the nucleoside building block of the 6-keto derivative of 2'-deoxy-5-methylcytidine (m5oxC) as an analog of an N3-protonated cytosine derivative is described. A series of 15mer oligonucleotides containing either four or six m5oxC residues has been prepared by chemical synthesis. Complexation of the 15 residue oligonucleotides with target 25mer duplexes results in DNA triplexes containing T-A-T and m5oxC-G-C base triplets. When the m5oxC-G-C base triplets are present in sequence positions that alternate with TAT base triplets, DNA triplexes are formed with Tm values that are pH independent in the range 6.4-8.5. A 25mer DNA duplex containing a series of five contiguous G-C base pairs cannot be effectively targeted with either m5C or M5oxC in the third strand. In the former case charge-charge repulsion effects likely lead to destabilization of the complex, while in the latter case ineffective base stacking may be to blame. However, if the m5C and M5oxC residues are present in the third strand in alternate sequence positions, then DNA triplexes can be formed with contiguous G-C targets even at pH 8.0.

Base Composition↗
PubMed1996

Ribozyme-mediated cleavage of a substrate analogue containing an internucleotide-bridging 5'-phosphorothioate: evidence for the single-metal model.

An oligonucleotide substrate containing a 5'-bridging phosphorothioate linkage adjacent to a ribonucleotide has been used to investigate the cleavage mechanisms of the hammerhead ribozyme and to probe the catalytic role of the metal cofactor(s). Specifically, we tested the hypothesis that a second metal interacts with the 5'-leaving group to facilitate the cleavage event. To this end, we have examined the ribozyme-mediated cleavage activity of the phosphorothioate substrate at pH 7.5 with a series of divalent metal in both the presence and absence of the polycation spermine. The cleavage products are found to be the same as for the native sequence under a variety of reaction conditions. The influence of divalent metal ion concentration, temperature, and pH on the cleavage rate also has been examined for both the oxo linkage and the thio analogue. Spermine (but not spermidine or NaCl) is shown to support efficient cleavage of the thio analogue in the absence [5 mM ethylenediaminetetraacetic acid (EDTA)] of a divalent metal cofactor. The cleavage of the oxo linkage exhibits a solvent deuterium isotope effect of 3.6, but a similar effect is not observed with the thio analogue. The pseudo-first-order rate constants for cleavage of the thio analogue in the presence of 10 mM Mg2+ or Mn2+ at pH 7.5 are 65 and 82 x 10(-3) min-1, respectively. The native oxo linkage is cleaved at essentially the same rate as the thio analogue (35 and 97 x 10(-3) min-1 for Mg2+ and Mn2+, respectively). The absence of an appreciable thio effect and the lack of a preference for either Mg2+ or Mn2+ provides compelling evidence that the metal cofactor does not interact with the 5'-thioanion (or oxyanion) leaving group in the transition state. These rate comparisons additionally reveal the the departure of the 5'-leaving group is not the rate-limiting step of the cleavage reaction catalyzed by the hammerhead ribozyme.

Base Sequence↗
PubMed1995

Cleavage properties of an oligonucleotide containing a bridged internucleotide 5'-phosphorothioate RNA linkage.

An oligonucleotide has been synthesized that contains a single bridging 5'-phosphorothioate at an RNA linkage (5'-ApCpGpGpTpCpTprCpsApCpGpApGpC-3'). This new phosphodiester linkage is found to be particularly susceptible to cleavage when compared with the corresponding oxo, deoxy and thiodeoxy derivatives. Divalent metal cations were observed to dramatically increase the cleavage rate. The products of the cleavage under a variety of conditions are a 5'-thiol-containing fragment (6mer) and a 2',3'-cyclic phosphate-containing fragment (8mer). The pseudo-first order rate constant, kobs, for cleavage at pH 7.5 (50 mM Tris-HCI) in the presence of 5 mM EDTA is 1.5 x 10(-4)/min. In the presence of 5 mM metal dichloride and 50 mM Tris-HCI, pH 7.5, the relative cleavage rate enhancements are 10, 24, 71, 98, 370 and 3400 for Mg2+, Ca2+, Mn2+, Co2+, Zn2+ and Cd2+ respectively. The rate enhancements correlate well with Pearson's HSAB principle, suggesting that cleavage is mediated in part by coordination of the metal to the 5'-mercapto leaving group. RNA linkages containing bridging 5'-phosphorothioates should prove valuable for studying the mechanistic details of a variety of RNA cleaving agents, such as ribozymes.

Amino Acid Sequence↗
PubMed1995

Effects of base analog substitutions in the noncoding dC of the 3'-d(CTG)-5' template recognition site of the bacteriophage T7 primase.

The 63-kDa gene 4 protein (DNA primase) of bacteriophage T7 catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC at single-stranded DNA recognition sites 3'-d[CTGG-(G/T)]-5' and 3'-d(CTGTG)-5', respectively. At these sites, the 3'-terminal deoxycytidine residue is conserved but noncoding; the 3'-dC residue is required to initiate catalytic synthesis of oligoribonucleotides, yet it is not used as a template residue for the synthesis of a complementary G residue in the RNA primer. We have examined the interactions between T7 primase and the functional groups of the 3'-dC residue by measuring the ability of the primase to catalyze the synthesis of oligoribonucleotides on synthetic single-stranded 20-mer templates [e.g., 3'-d(GCTATGGTGACTGGTAGTCG)-5'] that contain analogs of dC in the conserved pentanucleotide recognition site. Recognition sites containing 5-methyldeoxycytidine (m5dC) or 1-(beta-D-2'-deoxyribosyl)-2-pyrimidinone (dH4C) substitutions for dC support oligoribonucleotide synthesis whereas those containing deoxythymidine (dT) and deoxyuridine (dU) substitutions do not. Oligoribonucleotide synthesis on the native template (containing dC) is inhibited competitively by the template containing a dT residue in the primase recognition site, 3'-[(N10)TTGGT(N5)]-5', with an apparent Ki of 1.30 +/- 0.04 microM. Templates containing dU residues, 3'-[(N10)UTGGT(N5)]-5' and 3'-[(N9)UTTGGT-(N5)]-5', affect both the apparent Km and Vmax parameters for oligoribonucleotide synthesis on the 3'-[(N10)CTGGT(N5)]-5' template.

Bacteriophage T7↗
PubMed1995

Synthesis and properties of a Hoechst-like minor-groove binding agent tethered to an oligodeoxynucleotide.

A small Hoechst-like DNA groove-binding fluorophore carrying a terminal bromoacetimido linker has been synthesized. Individual diastereomeric oligodeoxynucleotide dodecamers containing a thiol-based linker attached to an internucleotide phosphoramidate within a sequence of dA-dT residues were each covalently labeled with the new fluorophore. One isomer of the DNA-fluorophore conjugate (Isomer B) hybridizes to the complementary single-stranded target DNA and the presence of the tethered fluorophore results in both increased duplex stability and an enhanced fluorescent signal, presumably due to the fluorophore binding in the dA-dT rich minor groove. Duplex stability is increased by 2-3 degrees C and the fluorescence quantum yield for the fluorophore increases four-fold. In contrast, the other diastereomer (Isomer A) exhibits reduced helix stability (approximately 2 degrees C) and only slight changes in fluorescence intensity upon hybridization.

Base Sequence↗
PubMed1994

Activity of the hammerhead ribozyme upon inversion of the stereocenters for the guanosine 2'-hydroxyls.

Two guanosine 2'-hydroxyls in the hammerhead RNA complex at positions G5 and G8 are critical for efficient cleavage by this RNA catalyst. These two functional groups are likely involved in the binding of the metal cofactor, or they are involved in specific interresidue hydrogen-bonding interactions. The importance of the stereochemical positioning of both critical 2'-hydroxyls was investigated by comparing the cleavage rates of three arabinosylguanine-substituted complexes (in which the positions of specific guanosine 2'-hydroxyls were stereochemically altered by inverting the C2' stereocenter) with that of the native complex, as well as with the rates of the dG- and dFG-substituted complexes [in which the 2'-hydroxyls are absent as the result of substitution by 2'-deoxyguanosine (dG) or 2'-deoxy-2'-fluoroguanosine (dFG)]. The G5araG and G8araG complexes exhibit dramatically different cleavage rates. The G5araG complex is essentially inactive, at least 10(5)-fold slower than the native complex. RNA cleavage by this analogue ribozyme is also 1000-fold slower than cleavage by either the G5dG or the G5dFG ribozyme, both of which lack the 2'-hydroxyl at G5. By comparison, catlytic efficiency of the G8araG complex as expressed by kcat/Km is comparable with that of the native complex and some 2 orders of magnitude more active than either the G8dG or the G8dFG complex.

Arabinose↗
PubMed1994

Specific purine N7-nitrogens are critical for high affinity binding by the trp repressor.

We have analysed the interaction of the trp repressor with the trpEDCBA operator using a series of modified trp operator sequences incorporating two isosteric purine analogues that lack N7-nitrogens. Our results suggest that as well as the direct contact between Arg69 and G-9, three additional purine N7-nitrogens, implicated in specific, water-mediated contacts to the repressor, are critical for formation of the high-affinity repressor-operator complex. We conclude that the crystal structure obtained by Otwinowski et al. reflects high-affinity sequence-specific binding of the trp repressor to the trp operator, and that in some cases proteins can use water molecules to extend amino acid side chains in order to derive favorable binding energy in complex formation.

Alkaline Phosphatase↗
PubMed1993

Importance of specific guanosine N7-nitrogens and purine amino groups for efficient cleavage by a hammerhead ribozyme.

Seven modified hammerhead ribozyme/substrate complexes have been prepared in which individual purine nitrogens, the guanine N7-, the guanine N2-, or the adenine N6-nitrogen, have been excised. The modified complexes were chemically synthesized with the substitution of a single 7-deazaguanosine (c7G), inosine (I), or nebularine (purine riboside, P) base analogue as appropriate for residues G5, G8, G12, A13, A14, or A15. Two of the base analogues, c7G5 and C7G8, occur in a 19-mer ribozyme, while the remaining three residues are present in a 24-mer substrate. Under stoichiometric conditions, four of the complexes, G5c7G, G8c7G, G12c7G, and A14P, are cleaved with relatively little change in rate when compared with the native complex. Two complexes, A13P and A15P, are cleaved some 6-8-fold slower than the native complex, while the G12I complex is reduced in rate by 50-fold. Steady-state kinetic analyses indicate that the cleavage efficiencies, as measured by kcat/KM values, for the G5c7G, G8c7G, and G12c7G complexes are only marginally reduced relative to the native complex. The values for the A13P, A14P, and A15P complexes are reduced by 25-, 15-, and 60-fold, respectively. These reductions in cleavage efficiency are primarily a result of lower kcat values. By comparison, the kcat/KM value for the G12I complex is decreased 450-fold relative to the native complex and is characterized by an 8-fold increase in KM and a kcat value that is reduced nearly 60-fold. These results indicate that the N2-amino group of G12 in the hammerhead ribozyme/substrate complex is critical for efficient cleavage activity.(ABSTRACT TRUNCATED AT 250 WORDS)

Amides↗
PubMed1992

Importance of specific adenosine N7-nitrogens for efficient cleavage by a hammerhead ribozyme. A model for magnesium binding.

Five modified hammerhead ribozyme/substrate complexes have been prepared in which individual adenosine N7-nitrogens have been excised. The modified complexes were chemically synthesized with the substitution of a single 7-deazaadenosine (c7A) base analogue for residues A11, A14, A26, A27, or A28. Two of the base analogues, c7A11 and c7A14, occur in a 19-mer ribozyme, while the remaining three residues, c7A26, c7A27, and c7A28, are present in a 24-mer substrate. Under stoichiometric conditions, four of the complexes are cleaved with relatively little change in rate when compared with that of the native complex. However, the relative rate for the c7A11 complex is some 35-fold slower than that of the native complex. Steady-state kinetic analyses indicate that the cleavage efficiencies, as measured by kcat/KM, for the c7A14, c7A26, c7A27, and c7A28 complexes are reduced 18-fold, 10-fold, 34-fold, and 16-fold, respectively. These reductions in cleavage efficiency are primarily a result of lower kcat values. By comparison, the cleavage efficiency of the c7A11 complex is reduced more than 200-fold relative to that of the native complex, again primarily as a result of a lower kcat value. The results suggest that the N7-nitrogen of A11 in the hammerhead ribozyme/substrate complex is critical for efficient cleavage activity. The results of the present work, in combination with those from previous reports, indicate that five critical functional groups are located within the tetrameric sequence G10A11U12G13. A preliminary model for the binding of a single magnesium cofactor to this portion of the sequence is proposed.(ABSTRACT TRUNCATED AT 250 WORDS)

Adenosine↗
PubMed1992

The estimation of distances between specific backbone-labeled sites in DNA using fluorescence resonance energy transfer.

A series DNA helices of twenty-four base pairs has been prepared for the study of fluorescence resonance energy transfer. Each of the DNA helices contains two phosphorothioate diesters (one in each strand) at pre-selected sites for introduction of the desired donor and acceptor fluorophores. The phosphorothioate-containing oligodeoxynucleotides have been prepared as pure Rp or Sp derivatives or as deastereomeric mixtures. Fluorescein and eosin are employed as the respective donor and acceptor fluorophores. A series of donor-acceptor pairs was generated by labeling of the appropriate phosphorothioate diester with the desired fluorophore and annealing the two complementary DNA strands (one containing the acceptor and one containing the donor fluorophore) to form the double-stranded helix. The 24-mer helices containing two covalently attached fluorophores exhibited some thermal destabilization and the extent of this destabilization was dependent upon the stereochemical orientation of the fluorophore. The Sp derivatives direct the fluorophore out, away from the the DNA helix, while the Rp derivatives direct the fluorophore toward the major groove. As expected, the Sp labeled duplexes were more stable than the corresponding Rp labeled sequences. However, all of the duplex structures formed were stable under the conditions used to measure energy transfer. Energy transfer could be observed with these complexes from the quenching of the donor fluorescence in the presence of the acceptor fluorophore. Using Förster's theories, distances separating the fluorophores could be calculated that were generally in reasonable agreement with the distances expected in an idealized B-form DNA helix. However anomalous results were obtained for one donor/acceptor pair where the expected distance was less than 20 A. Fluorescence anisotropy values determined in solutions of varying viscosity were quite high suggesting that the fluorophores did not experience complete freedom of movement when attached to the DNA helix.

Base Composition↗
PubMed1992

Interactions between the trp repressor and its operator sequence as studied by base analogue substitution.

A series of modified trp operator sequences has been prepared by the incorporation of seven different base analogues. Four of the analogues allow the site-specific deletion of functional groups present on the dA-dT and dT-dA base pairs at positions -4/+4 and -5/+5 in the trp operator. The remaining three analogues permit the incorporation of structural analogues of the native dA-dT or dG-dC base pairs. The duplex operator sequences all exhibit Tm values well above ambient temperature (48-70 degrees C), and these values generally correlate very well with the number of interstrand hydrogen bonds present. The affinity between the trp repressor and 14 modified operator sequences was examined using a recently developed alkaline phosphatase protection assay. The results from the analogue sequences used in this study suggest that the structure of the dA-dT or dT-dA base pairs at positions -4/+4 and -5/+5, respectively, has relatively little effect upon the solution binding by the trp repressor, but the protein is very sensitive to the orientation of the amino and carbonyl functional groups at the -4/+4 positions, which are involved in the formation of an interbase hydrogen bond present in the major groove. (The term structure in this case refers to the hydrogen bonding structure of the base pairs. We recognize that the introduction of conservative functional group deletions or reversals may affect other structural criteria such as hydration.) The deletion of individual functional groups from the operator sequence suggests that the carbonyl at dT+4 is critical for formation of the high-affinity sequence-specific complex. Additionally, the thymine methyl group at dT+4 and the N7 nitrogen of dA+5 appear to be critical contacts necessary for high-affinity binding by the repressor. The thymine carbonyl and the adenine N7 nitrogen are each responsible for approximately -1.5 kcal/mol of apparent free energy of binding. The thymine methyl provides a somewhat smaller contribution of -0.7 kcal/mol. Deletion of either of the adenine amino groups at dA-4 or dA+5 results in a sequence that binds to the repressor with a higher affinity than observed with the native sequence; this can be explained in that the functional groups lost are not critical for binding, and the resulting increased flexibility of the operator, or the creation of a more hydrophobic surface at these sites, enhances van der Waals contacts between the protein and the nucleic acid.

Bacterial Proteins↗
PubMed1992

DNA curvature does not require bifurcated hydrogen bonds or pyrimidine methyl groups.

Short tracts of the homopolymer dA.dT confer intrinsic curvature on the axis of the DNA double helix. This phenomenon is assumed to be a consequence of such tracts adopting a stable B'-DNA conformation that is distinct from B-form structure normally assumed by other DNA sequences. The more stable B' structure of dA.dT tracts has been attributed to several possible stabilizing factors: (1) optimal base stacking interactions consequent upon the high propeller twist, (2) bifurcated hydrogen bonds between adjacent dA.dT base-pairs, (3) stacking interactions involving the dT methyl groups, and finally (4) a putative spine of ordered water molecules in the minor groove. DNA oligodeoxynucleotides have been synthesized that enable these hypotheses to be tested; of particular interest is the combination of effects due to bifurcation (2) and methylation of the pyrimidines nucleotides (3). The data indicate that neither bifurcated hydrogen bonds nor pyrimidine methyl groups nor both are essential for DNA curvature. The data further suggest that the influence of the minor groove spine of hydration on the B'-formation is small. The experiments favor the hypothesis that base stacking interactions are the dominant force in stabilizing the B'-form structure.

Base Sequence↗
PubMed1992

Importance of specific purine amino and hydroxyl groups for efficient cleavage by a hammerhead ribozyme.

Eight modified ribozymes of 19 residues have been prepared with individual purine amino or hydroxyl groups excised. The modified ribozymes were chemically synthesized with the substitution of a single 2'-deoxyadenosine, 2'-deoxyguanosine, inosine, or purine riboside for residues G10, A11, G13, or A14. Five of the modified ribozymes cleaved the 24-mer substrate with little change in rate as monitored by simple first-order kinetics. However, deletion of the 2-amino group at G10 (replacement with inosine) or deletion of either of the 2'-hydroxyls at G10 or G13 (replacement with 2'-deoxyguanosine) resulted in ribozymes with a drastic decrease in cleavage efficiency. Increasing the concentration of the Mg2+ cofactor from 10 mM to 50 mM significantly enhanced cleavage efficiency by these three derivatives. Steady-state kinetic assays for these three ribozymes indicated that the modifications result in both an increase in Km and a decrease in kcat. These results suggest that the exocyclic amino group at-G10 and the hydroxyls at G10 and G13 are important both for ribozyme-substrate binding and for the Mg(2+)-catalyzed cleavage reaction.

Base Sequence↗
PubMed1992

Properties of pseudouridine N1 imino protons located in the major groove of an A-form RNA duplex.

The exchangeable N1 imino protons of two pseudouridine (psi) bases located at adjacent internal positions within an undecamer RNA duplex (5'AUAC psi psi ACCUG/3'UAUGAAUGGUC) can report on the environment of the major groove of an A-form double-stranded nucleic acid. The psi N1 imino protons of these residues (which are not involved in interstrand Watson-Crick hydrogen bonding) are protected from chemical exchange with the solvent water and thus are observable in the proton NMR spectrum in H2O (1). These protons will exchange readily at increased pH values or upon thermal denaturation of the duplex. The longitudinal (T1) relaxation times of the psi N1 imino protons in 100 mM NaCl or in 10 mM MgCl2 and 100 mM NaCl are approximately two-fold faster than those of the psi N3 imino protons which are involved in Watson-Crick base pairing. With the addition of spermidine, the psi N1 imino protons become readily exchangeable at a temperature some 20 degrees C below the melting temperature of the duplex.

Base Sequence↗
PubMed1992

Thermodynamics of interaction of a fluorescent DNA oligomer with the anti-tumour drug netropsin.

Fluorescence spectroscopy was used to study the interaction between the minor-groove-binding drug netropsin and the self-complementary oligonucleotide d(CTGAnPTTCAG)2 containing the fluorescent base analogue 2-aminopurine (nP). The binding of netropsin to this oligonucleotide causes strong quenching of the 2-aminopurine fluorescence, observed by steady-state as well as time-resolved spectroscopy. From fluorescence titrations, binding isotherms were recorded and evaluated. The parameters showed one netropsin binding site/oligonucleotide duplex and an association constant of about 10(5) M-1 at 25 degrees C, 3-4 orders of magnitude weaker than for an exclusive adenine/thymine host sequence. From the temperature dependence of the association constant the thermodynamic parameters were obtained as delta G = -29 kJ/mol, delta H = -12 kJ/mol and delta S = +55 J.mol-1.K-1 at 25 degrees C. These parameters resemble those of the interaction of poly[(dG-dC).(dG-dC)] with netropsin, indicating a mainly entropy-driven reaction. The amino group of 2-aminopurine, like that of guanine, resides in the minor groove of DNA. Therefore the relatively weak binding of netropsin to d(CTGAnPTTCAG)2 is probably related to partial blockage of the tight fit of netropsin into the preferred minor groove of an exclusive adenine/thymine host sequence.

2-Aminopurine↗